Incidental Mutation 'R2679:Tcf7l1'
ID250747
Institutional Source Beutler Lab
Gene Symbol Tcf7l1
Ensembl Gene ENSMUSG00000055799
Gene Nametranscription factor 7 like 1 (T cell specific, HMG box)
SynonymsTcf3
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location72626378-72789254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 72627420 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 580 (H580Q)
Ref Sequence ENSEMBL: ENSMUSP00000109687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069536] [ENSMUST00000114053]
Predicted Effect probably benign
Transcript: ENSMUST00000069536
AA Change: H566Q

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000069403
Gene: ENSMUSG00000055799
AA Change: H566Q

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 248 1.3e-77 PFAM
HMG 342 412 3.47e-21 SMART
low complexity region 418 426 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081929
Predicted Effect probably benign
Transcript: ENSMUST00000114053
AA Change: H580Q

PolyPhen 2 Score 0.434 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109687
Gene: ENSMUSG00000055799
AA Change: H580Q

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 262 6.9e-91 PFAM
HMG 356 426 3.47e-21 SMART
low complexity region 432 440 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 489 508 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156497
Meta Mutation Damage Score 0.1347 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the T cell factor/lymphoid enhancer factor family of transcription factors. These transcription factors are activated by beta catenin, mediate the Wnt signaling pathway and are antagonized by the transforming growth factor beta signaling pathway. The encoded protein contains a high mobility group-box DNA binding domain and participates in the regulation of cell cycle genes and cellular senescence. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit severe embryological defects particularly affecting the cardiovascular system, nervous system, and digestive system. No homozygous embryos survive beyond E11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Tcf7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Tcf7l1 APN 6 72629983 missense probably benign 0.00
IGL03167:Tcf7l1 APN 6 72632996 missense possibly damaging 0.75
R0731:Tcf7l1 UTSW 6 72788269 missense possibly damaging 0.83
R2887:Tcf7l1 UTSW 6 72632088 missense probably damaging 1.00
R4015:Tcf7l1 UTSW 6 72636399 intron probably benign
R4433:Tcf7l1 UTSW 6 72788769 missense probably damaging 0.96
R4671:Tcf7l1 UTSW 6 72649178 missense probably damaging 0.99
R5262:Tcf7l1 UTSW 6 72636466 intron probably benign
R5891:Tcf7l1 UTSW 6 72637051 intron probably benign
R6767:Tcf7l1 UTSW 6 72631292 missense probably damaging 0.98
R7255:Tcf7l1 UTSW 6 72627347 utr 3 prime probably null
X0027:Tcf7l1 UTSW 6 72788739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAACAGTCCAGAGTGGTC -3'
(R):5'- AGAAGCCTTGTGATAGCCCTG -3'

Sequencing Primer
(F):5'- CAGTCCAGAGTGGTCAAATATTG -3'
(R):5'- TGCGTCTTCCCATGGCAG -3'
Posted On2014-12-04