Incidental Mutation 'R2679:Olfr572'
ID250759
Institutional Source Beutler Lab
Gene Symbol Olfr572
Ensembl Gene ENSMUSG00000073963
Gene Nameolfactory receptor 572
SynonymsGA_x6K02T2PBJ9-5638785-5639741, MOR10-2
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R2679 (G1)
Quality Score218
Status Validated
Chromosome7
Chromosomal Location102924409-102928608 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 102928031 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 134 (Y134*)
Ref Sequence ENSEMBL: ENSMUSP00000149174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098214] [ENSMUST00000214096] [ENSMUST00000215782]
Predicted Effect probably null
Transcript: ENSMUST00000098214
AA Change: Y134*
SMART Domains Protein: ENSMUSP00000095816
Gene: ENSMUSG00000073963
AA Change: Y134*

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 3.6e-119 PFAM
Pfam:7TM_GPCR_Srsx 37 309 2e-7 PFAM
Pfam:7tm_1 43 294 1e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214096
AA Change: Y134*
Predicted Effect probably null
Transcript: ENSMUST00000215782
AA Change: Y134*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Olfr572
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01567:Olfr572 APN 7 102928416 missense probably benign 0.03
IGL02015:Olfr572 APN 7 102928192 missense probably benign 0.06
IGL02466:Olfr572 APN 7 102928516 missense possibly damaging 0.88
R0632:Olfr572 UTSW 7 102928604 utr 3 prime probably null
R1852:Olfr572 UTSW 7 102928441 missense probably damaging 1.00
R2033:Olfr572 UTSW 7 102928408 missense probably benign 0.00
R4520:Olfr572 UTSW 7 102928557 missense probably benign
R4596:Olfr572 UTSW 7 102928251 missense possibly damaging 0.74
R5538:Olfr572 UTSW 7 102928521 missense probably damaging 1.00
R6477:Olfr572 UTSW 7 102928378 missense probably damaging 1.00
R7028:Olfr572 UTSW 7 102927942 missense probably damaging 1.00
R8034:Olfr572 UTSW 7 102928566 nonsense probably null
Z1177:Olfr572 UTSW 7 102927644 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTTGCAGATATGGGGC -3'
(R):5'- GGCCATAGAGACTGTTGACACG -3'

Sequencing Primer
(F):5'- CATTTGCAGATATGGGGCTCACC -3'
(R):5'- AGACTGTTGACACGGGTGC -3'
Posted On2014-12-04