Incidental Mutation 'R2679:Tead1'
ID250761
Institutional Source Beutler Lab
Gene Symbol Tead1
Ensembl Gene ENSMUSG00000055320
Gene NameTEA domain family member 1
SynonymsGtrgeo5, mTEF-1, 2610024B07Rik, TEAD-1, B230114H05Rik, TEF-1, Tcf13
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location112679318-112906807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 112856846 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 115 (S115A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059768] [ENSMUST00000069256] [ENSMUST00000084705] [ENSMUST00000106638] [ENSMUST00000164363] [ENSMUST00000165036] [ENSMUST00000168981] [ENSMUST00000170352] [ENSMUST00000171197]
Predicted Effect probably benign
Transcript: ENSMUST00000059768
AA Change: S137A

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060671
Gene: ENSMUSG00000055320
AA Change: S137A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
Pfam:TEA 95 428 3e-127 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000069256
AA Change: S112A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000130459
Gene: ENSMUSG00000055320
AA Change: S112A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 128 144 N/A INTRINSIC
PDB:3KYS|C 194 411 1e-153 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000084705
AA Change: S112A

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081755
Gene: ENSMUSG00000055320
AA Change: S112A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 128 144 N/A INTRINSIC
PDB:3KYS|C 194 411 1e-153 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000106638
AA Change: S116A

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000102249
Gene: ENSMUSG00000055320
AA Change: S116A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
PDB:3KYS|C 198 415 1e-153 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000164363
AA Change: S137A

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127574
Gene: ENSMUSG00000055320
AA Change: S137A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
internal_repeat_1 95 119 8.98e-7 PROSPERO
low complexity region 153 169 N/A INTRINSIC
PDB:3KYS|C 219 436 1e-153 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000165036
AA Change: S116A

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131221
Gene: ENSMUSG00000055320
AA Change: S116A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
PDB:3KYS|C 198 415 1e-153 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000167060
AA Change: S115A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130564
Gene: ENSMUSG00000055320
AA Change: S115A

DomainStartEndE-ValueType
Pfam:TEA 1 128 1.8e-28 PFAM
low complexity region 132 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168981
AA Change: S95A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133025
Gene: ENSMUSG00000055320
AA Change: S95A

DomainStartEndE-ValueType
Pfam:TEA 1 386 7.1e-166 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170352
AA Change: S91A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129798
Gene: ENSMUSG00000055320
AA Change: S91A

DomainStartEndE-ValueType
Pfam:TEA 1 382 4.5e-163 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171197
AA Change: S116A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128439
Gene: ENSMUSG00000055320
AA Change: S116A

DomainStartEndE-ValueType
TEA 11 82 3.67e-52 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:TEA 222 349 3e-59 PFAM
Meta Mutation Damage Score 0.5817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous transcriptional enhancer factor that is a member of the TEA/ATTS domain family. This protein directs the transactivation of a wide variety of genes and, in placental cells, also acts as a transcriptional repressor. Mutations in this gene cause Sveinsson's chorioretinal atrophy. Additional transcript variants have been described but their full-length natures have not been experimentally verified. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene die between embryonic day 11 and 12.5. Abnormalities were seen in heart development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Tead1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Tead1 APN 7 112839455 missense probably damaging 1.00
IGL00678:Tead1 APN 7 112841880 splice site probably null
IGL02640:Tead1 APN 7 112861456 missense probably benign 0.09
R0635:Tead1 UTSW 7 112891706 splice site probably benign
R1469:Tead1 UTSW 7 112876184 missense probably damaging 1.00
R1469:Tead1 UTSW 7 112876184 missense probably damaging 1.00
R1981:Tead1 UTSW 7 112891745 missense probably benign 0.03
R2866:Tead1 UTSW 7 112759487 missense probably damaging 0.98
R4060:Tead1 UTSW 7 112876062 splice site probably null
R4810:Tead1 UTSW 7 112841866 intron probably null
R5253:Tead1 UTSW 7 112861545 missense probably damaging 1.00
R5266:Tead1 UTSW 7 112759466 utr 5 prime probably benign
R6316:Tead1 UTSW 7 112891839 missense probably damaging 1.00
R6479:Tead1 UTSW 7 112861465 missense probably benign 0.00
R6562:Tead1 UTSW 7 112861443 missense probably benign
R7178:Tead1 UTSW 7 112841937 missense probably benign 0.00
R7207:Tead1 UTSW 7 112842080 missense possibly damaging 0.78
R7996:Tead1 UTSW 7 112842104 critical splice donor site probably null
R8037:Tead1 UTSW 7 112759520 missense possibly damaging 0.67
R8057:Tead1 UTSW 7 112759514 missense probably benign
X0028:Tead1 UTSW 7 112859116 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GTGTGCTTTCATGGCCCC -3'
(R):5'- ATCCACCTAGCATCACCTATCAT -3'

Sequencing Primer
(F):5'- TTTCATGGCCCCCGTGTGG -3'
(R):5'- TGACGGGCAAATGCTCTACTACTG -3'
Posted On2014-12-04