Incidental Mutation 'R2679:Ubl7'
ID250777
Institutional Source Beutler Lab
Gene Symbol Ubl7
Ensembl Gene ENSMUSG00000055720
Gene Nameubiquitin-like 7 (bone marrow stromal cell-derived)
Synonyms
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location57910979-57929968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57914599 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 77 (D77G)
Ref Sequence ENSEMBL: ENSMUSP00000150925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163329] [ENSMUST00000213654] [ENSMUST00000214086] [ENSMUST00000216260] [ENSMUST00000216841] [ENSMUST00000216925] [ENSMUST00000217129] [ENSMUST00000217132] [ENSMUST00000217180]
Predicted Effect probably damaging
Transcript: ENSMUST00000163329
AA Change: D77G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126019
Gene: ENSMUSG00000055720
AA Change: D77G

DomainStartEndE-ValueType
UBQ 6 92 3.53e-5 SMART
low complexity region 206 221 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
low complexity region 270 293 N/A INTRINSIC
UBA 338 376 4.92e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000213654
AA Change: D104G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000214086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215751
Predicted Effect possibly damaging
Transcript: ENSMUST00000216260
AA Change: D77G

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably damaging
Transcript: ENSMUST00000216841
AA Change: D77G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216925
AA Change: D77G

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217129
AA Change: D77G

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000217132
AA Change: D77G

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217180
AA Change: D77G

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.0936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Ubl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
breakdown UTSW 9 57929756 missense probably damaging 1.00
vaticano UTSW 1 57920510 missense
R1457:Ubl7 UTSW 9 57914611 missense probably damaging 1.00
R2102:Ubl7 UTSW 9 57920542 missense probably damaging 1.00
R6277:Ubl7 UTSW 9 57923272 missense possibly damaging 0.80
R6317:Ubl7 UTSW 9 57911173 critical splice donor site probably null
R6436:Ubl7 UTSW 9 57920510 missense probably damaging 1.00
R6768:Ubl7 UTSW 9 57912762 missense probably benign 0.00
R7156:Ubl7 UTSW 9 57929756 missense probably damaging 1.00
R7361:Ubl7 UTSW 9 57914622 missense probably damaging 1.00
R7459:Ubl7 UTSW 9 57914592 missense probably damaging 1.00
R7527:Ubl7 UTSW 9 57912884 missense unknown
R7670:Ubl7 UTSW 9 57929769 missense probably benign 0.00
R7687:Ubl7 UTSW 9 57914584 missense probably damaging 1.00
R7831:Ubl7 UTSW 9 57914635 missense possibly damaging 0.73
R8031:Ubl7 UTSW 9 57923206 missense probably damaging 1.00
Z1176:Ubl7 UTSW 9 57919345 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGTGTACAGAAGTATGCACTC -3'
(R):5'- TTTGGTAATCACCCAGGACTG -3'

Sequencing Primer
(F):5'- TTCAGCCACTGGTATTACAGGCG -3'
(R):5'- TGGTAATCACCCAGGACTGTATCC -3'
Posted On2014-12-04