Incidental Mutation 'R2484:Dhx36'
ID250778
Institutional Source Beutler Lab
Gene Symbol Dhx36
Ensembl Gene ENSMUSG00000027770
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 36
Synonyms2810407E23Rik, Ddx36
MMRRC Submission 040408-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2484 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location62468013-62507004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62472815 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 820 (N820I)
Ref Sequence ENSEMBL: ENSMUSP00000029336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029336]
Predicted Effect probably damaging
Transcript: ENSMUST00000029336
AA Change: N820I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029336
Gene: ENSMUSG00000027770
AA Change: N820I

DomainStartEndE-ValueType
low complexity region 10 45 N/A INTRINSIC
DEXDc 198 389 1.53e-31 SMART
HELICc 495 600 5.61e-16 SMART
HA2 662 753 2.23e-26 SMART
Pfam:OB_NTP_bind 792 910 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160858
Meta Mutation Damage Score 0.8212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the DEAH-box family of RNA-dependent NTPases which are named after the conserved amino acid sequence Asp-Glu-Ala-His in motif II. The protein encoded by this gene has been shown to enhance the deadenylation and decay of mRNAs with 3'-UTR AU-rich elements (ARE-mRNA). The protein has also been shown to resolve into single strands the highly stable tetramolecular DNA configuration (G4) that can form spontaneously in guanine-rich regions of DNA. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lethality around E7.0. Mice homozygous for a conditional allele activated in the hematopoiesis systemexhibit impaired erythropoiesis associated with cell cycle defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,641 N252S probably benign Het
4932414N04Rik G A 2: 68,711,475 D46N possibly damaging Het
A830018L16Rik G T 1: 11,596,302 A278S probably damaging Het
Adarb2 A T 13: 8,569,774 K99* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn1l A G 8: 109,732,251 S460P probably damaging Het
Bicra T A 7: 15,988,680 N304I possibly damaging Het
Capn10 A T 1: 92,944,843 D470V probably damaging Het
Chchd3 A G 6: 32,804,015 Y184H possibly damaging Het
Col6a6 T C 9: 105,780,804 I736M probably damaging Het
Drd4 C T 7: 141,294,736 P347S probably benign Het
Ephx1 A T 1: 180,989,972 V378D probably damaging Het
Extl3 A T 14: 65,075,735 V666E probably damaging Het
Fam20c G C 5: 138,809,117 R500S probably benign Het
Glod4 A T 11: 76,239,518 D42E probably damaging Het
Golga2 T C 2: 32,304,770 I643T probably benign Het
Hnf1b A T 11: 83,861,835 T73S probably benign Het
Hydin A G 8: 110,513,115 Y2009C possibly damaging Het
Ido2 A G 8: 24,533,815 C336R probably damaging Het
Ifngr1 T C 10: 19,601,415 V108A probably damaging Het
Igbp1b A T 6: 138,657,494 N317K probably benign Het
Ints14 A G 9: 64,986,084 S511G probably benign Het
Itpr1 T C 6: 108,369,110 S125P probably damaging Het
Jag1 T C 2: 137,084,700 T975A possibly damaging Het
Klra17 A G 6: 129,868,757 W165R probably damaging Het
Leo1 T A 9: 75,445,473 N99K possibly damaging Het
Lonp1 C A 17: 56,614,659 G883C probably damaging Het
Lpin1 C A 12: 16,547,499 G682W probably damaging Het
Macf1 A C 4: 123,473,672 L2432R probably damaging Het
Med12l T G 3: 59,297,838 I2075M probably benign Het
Mroh6 A G 15: 75,884,328 S660P probably benign Het
Myh6 G T 14: 54,961,242 Y309* probably null Het
Myof C T 19: 37,903,843 R1154H probably benign Het
Myrip G A 9: 120,424,619 E253K probably benign Het
Ndst3 T C 3: 123,552,537 D281G possibly damaging Het
Nipbl T C 15: 8,323,698 K1788R probably damaging Het
Nol12 A G 15: 78,940,517 probably benign Het
Nptn A G 9: 58,643,673 T212A possibly damaging Het
Nptx2 C T 5: 144,556,345 A414V probably damaging Het
Nub1 A G 5: 24,708,702 D503G possibly damaging Het
Obscn T A 11: 59,007,540 probably benign Het
Olfr1253 A G 2: 89,752,234 I198T probably benign Het
Olfr1447 C T 19: 12,901,641 M46I probably benign Het
Olfr635 A G 7: 103,979,338 T49A probably benign Het
Pcnx2 T C 8: 125,891,120 E132G probably damaging Het
Pkdcc A G 17: 83,222,238 probably benign Het
Prdm2 T A 4: 143,135,206 I505F probably damaging Het
Psmc3 C G 2: 91,056,001 Q169E probably damaging Het
Ptger4 A T 15: 5,235,173 I334N probably benign Het
Ptrh1 T C 2: 32,777,171 M161T probably benign Het
Rapgef6 T A 11: 54,642,756 V482D possibly damaging Het
Rdh16f2 T C 10: 127,875,077 S188P probably damaging Het
Rrh T C 3: 129,822,391 Y31C probably damaging Het
Selp G T 1: 164,143,954 W659L probably benign Het
Selp G T 1: 164,143,955 W659C probably damaging Het
Shh A G 5: 28,466,742 C8R probably benign Het
Spdye4b C A 5: 143,202,093 S167R possibly damaging Het
Strip1 T C 3: 107,628,221 Y62C possibly damaging Het
Sucla2 A T 14: 73,581,709 I232F probably benign Het
Sugp1 A G 8: 70,069,524 D437G possibly damaging Het
Taf1a A G 1: 183,396,084 probably benign Het
Tbc1d20 T A 2: 152,311,363 M271K probably damaging Het
Tecpr2 T C 12: 110,933,318 S707P probably benign Het
Tert G A 13: 73,647,985 R1017H probably benign Het
Tox C G 4: 6,688,886 V493L probably damaging Het
Tpo C T 12: 30,103,969 A246T probably benign Het
Traf7 A T 17: 24,511,639 V358D probably damaging Het
Trim56 C T 5: 137,112,674 V663M possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usf3 C T 16: 44,220,682 H1842Y probably damaging Het
Uvrag T C 7: 98,888,461 E509G probably benign Het
Vmn2r5 T C 3: 64,503,971 D305G possibly damaging Het
Vmn2r52 T C 7: 10,169,131 R457G probably damaging Het
Vti1a A C 19: 55,380,979 N101T possibly damaging Het
Zfp236 A G 18: 82,668,637 F259L probably benign Het
Other mutations in Dhx36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Dhx36 APN 3 62470558 utr 3 prime probably benign
IGL00538:Dhx36 APN 3 62501045 missense probably benign 0.04
IGL00706:Dhx36 APN 3 62496842 missense probably damaging 1.00
IGL02040:Dhx36 APN 3 62501015 missense probably benign
IGL02141:Dhx36 APN 3 62493889 missense probably benign 0.25
IGL02514:Dhx36 APN 3 62500898 missense possibly damaging 0.63
IGL02540:Dhx36 APN 3 62506888 missense probably benign 0.07
IGL02629:Dhx36 APN 3 62506734 missense probably benign 0.01
IGL02858:Dhx36 APN 3 62477376 splice site probably benign
IGL03305:Dhx36 APN 3 62500836 nonsense probably null
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0002:Dhx36 UTSW 3 62480839 missense probably damaging 1.00
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0021:Dhx36 UTSW 3 62477595 missense possibly damaging 0.66
R0671:Dhx36 UTSW 3 62493741 missense possibly damaging 0.96
R0735:Dhx36 UTSW 3 62472729 missense probably benign 0.00
R0782:Dhx36 UTSW 3 62506714 splice site probably benign
R1725:Dhx36 UTSW 3 62506939 start codon destroyed probably benign 0.01
R1951:Dhx36 UTSW 3 62484273 missense probably damaging 0.99
R1959:Dhx36 UTSW 3 62479385 missense probably benign 0.01
R2257:Dhx36 UTSW 3 62477643 missense probably damaging 1.00
R2397:Dhx36 UTSW 3 62498097 missense probably benign 0.00
R2973:Dhx36 UTSW 3 62495495 missense probably benign 0.00
R2973:Dhx36 UTSW 3 62495498 missense possibly damaging 0.56
R3617:Dhx36 UTSW 3 62472007 missense possibly damaging 0.96
R3617:Dhx36 UTSW 3 62487060 missense probably benign 0.01
R3725:Dhx36 UTSW 3 62488222 splice site probably benign
R3898:Dhx36 UTSW 3 62492369 missense probably damaging 0.98
R4332:Dhx36 UTSW 3 62484991 missense probably damaging 1.00
R4359:Dhx36 UTSW 3 62475278 missense probably benign 0.05
R4493:Dhx36 UTSW 3 62488504 intron probably benign
R4652:Dhx36 UTSW 3 62500998 missense probably benign 0.01
R4866:Dhx36 UTSW 3 62472777 missense probably damaging 1.00
R4884:Dhx36 UTSW 3 62484260 missense probably damaging 1.00
R4960:Dhx36 UTSW 3 62496859 missense probably damaging 1.00
R5083:Dhx36 UTSW 3 62471999 missense probably benign 0.17
R5162:Dhx36 UTSW 3 62493780 missense probably damaging 1.00
R5815:Dhx36 UTSW 3 62493755 missense probably damaging 1.00
R6090:Dhx36 UTSW 3 62496820 missense probably damaging 0.98
R6392:Dhx36 UTSW 3 62494369 missense probably benign 0.00
R6433:Dhx36 UTSW 3 62484974 missense probably damaging 1.00
R6504:Dhx36 UTSW 3 62488639 missense probably benign
R6615:Dhx36 UTSW 3 62488917 missense probably benign
R6672:Dhx36 UTSW 3 62495536 missense probably damaging 1.00
R6672:Dhx36 UTSW 3 62500879 missense probably benign 0.00
R7172:Dhx36 UTSW 3 62501015 missense probably benign
R7302:Dhx36 UTSW 3 62479393 missense probably benign
R7487:Dhx36 UTSW 3 62484202 missense possibly damaging 0.91
R7515:Dhx36 UTSW 3 62472087 missense probably benign 0.45
R7531:Dhx36 UTSW 3 62484968 missense probably damaging 1.00
R7579:Dhx36 UTSW 3 62480873 missense possibly damaging 0.64
R7726:Dhx36 UTSW 3 62488968 missense probably benign 0.01
R7874:Dhx36 UTSW 3 62488631 missense probably benign
R8056:Dhx36 UTSW 3 62488591 missense possibly damaging 0.93
R8226:Dhx36 UTSW 3 62470570 missense probably benign 0.01
R8361:Dhx36 UTSW 3 62480800 critical splice donor site probably null
R8529:Dhx36 UTSW 3 62506856 small deletion probably benign
R8737:Dhx36 UTSW 3 62479326 missense probably benign
R8947:Dhx36 UTSW 3 62472966 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGACAGATCCCTATGTTCACC -3'
(R):5'- AGCATCTTCTTGGAGCTGG -3'

Sequencing Primer
(F):5'- GACAGATCCCTATGTTCACCGATTC -3'
(R):5'- CTGGATTTGTAAGCAGTAGAAGTCCC -3'
Posted On2014-12-04