Incidental Mutation 'R2679:Med13'
ID250795
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86298577 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1169 (S1169P)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect probably benign
Transcript: ENSMUST00000043624
AA Change: S1169P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: S1169P

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Meta Mutation Damage Score 0.0695 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp273 C T 13: 67,825,776 A341V probably benign Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0646:Med13 UTSW 11 86331089 missense possibly damaging 0.95
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
R7586:Med13 UTSW 11 86271002 missense probably damaging 0.99
R7704:Med13 UTSW 11 86345918 nonsense probably null
R8062:Med13 UTSW 11 86319438 missense probably benign
Z1176:Med13 UTSW 11 86328544 missense possibly damaging 0.91
Z1176:Med13 UTSW 11 86345862 missense probably benign 0.45
Z1176:Med13 UTSW 11 86355423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCAGCAGTCACTACAACAG -3'
(R):5'- ATATCAAGGGTGCCGATGTTG -3'

Sequencing Primer
(F):5'- GTCACTACAACAGTCCCGCTC -3'
(R):5'- GTTGGAGTTTACATTCCAGACCCAAC -3'
Posted On2014-12-04