Incidental Mutation 'R2484:Prdm2'
ID250796
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission 040408-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2484 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143135206 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 505 (I505F)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably damaging
Transcript: ENSMUST00000105778
AA Change: I505F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: I505F

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197026
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,641 N252S probably benign Het
4932414N04Rik G A 2: 68,711,475 D46N possibly damaging Het
A830018L16Rik G T 1: 11,596,302 A278S probably damaging Het
Adarb2 A T 13: 8,569,774 K99* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn1l A G 8: 109,732,251 S460P probably damaging Het
Bicra T A 7: 15,988,680 N304I possibly damaging Het
Capn10 A T 1: 92,944,843 D470V probably damaging Het
Chchd3 A G 6: 32,804,015 Y184H possibly damaging Het
Col6a6 T C 9: 105,780,804 I736M probably damaging Het
Dhx36 T A 3: 62,472,815 N820I probably damaging Het
Drd4 C T 7: 141,294,736 P347S probably benign Het
Ephx1 A T 1: 180,989,972 V378D probably damaging Het
Extl3 A T 14: 65,075,735 V666E probably damaging Het
Fam20c G C 5: 138,809,117 R500S probably benign Het
Glod4 A T 11: 76,239,518 D42E probably damaging Het
Golga2 T C 2: 32,304,770 I643T probably benign Het
Hnf1b A T 11: 83,861,835 T73S probably benign Het
Hydin A G 8: 110,513,115 Y2009C possibly damaging Het
Ido2 A G 8: 24,533,815 C336R probably damaging Het
Ifngr1 T C 10: 19,601,415 V108A probably damaging Het
Igbp1b A T 6: 138,657,494 N317K probably benign Het
Ints14 A G 9: 64,986,084 S511G probably benign Het
Itpr1 T C 6: 108,369,110 S125P probably damaging Het
Jag1 T C 2: 137,084,700 T975A possibly damaging Het
Klra17 A G 6: 129,868,757 W165R probably damaging Het
Leo1 T A 9: 75,445,473 N99K possibly damaging Het
Lonp1 C A 17: 56,614,659 G883C probably damaging Het
Lpin1 C A 12: 16,547,499 G682W probably damaging Het
Macf1 A C 4: 123,473,672 L2432R probably damaging Het
Med12l T G 3: 59,297,838 I2075M probably benign Het
Mroh6 A G 15: 75,884,328 S660P probably benign Het
Myh6 G T 14: 54,961,242 Y309* probably null Het
Myof C T 19: 37,903,843 R1154H probably benign Het
Myrip G A 9: 120,424,619 E253K probably benign Het
Ndst3 T C 3: 123,552,537 D281G possibly damaging Het
Nipbl T C 15: 8,323,698 K1788R probably damaging Het
Nol12 A G 15: 78,940,517 probably benign Het
Nptn A G 9: 58,643,673 T212A possibly damaging Het
Nptx2 C T 5: 144,556,345 A414V probably damaging Het
Nub1 A G 5: 24,708,702 D503G possibly damaging Het
Obscn T A 11: 59,007,540 probably benign Het
Olfr1253 A G 2: 89,752,234 I198T probably benign Het
Olfr1447 C T 19: 12,901,641 M46I probably benign Het
Olfr635 A G 7: 103,979,338 T49A probably benign Het
Pcnx2 T C 8: 125,891,120 E132G probably damaging Het
Pkdcc A G 17: 83,222,238 probably benign Het
Psmc3 C G 2: 91,056,001 Q169E probably damaging Het
Ptger4 A T 15: 5,235,173 I334N probably benign Het
Ptrh1 T C 2: 32,777,171 M161T probably benign Het
Rapgef6 T A 11: 54,642,756 V482D possibly damaging Het
Rdh16f2 T C 10: 127,875,077 S188P probably damaging Het
Rrh T C 3: 129,822,391 Y31C probably damaging Het
Selp G T 1: 164,143,954 W659L probably benign Het
Selp G T 1: 164,143,955 W659C probably damaging Het
Shh A G 5: 28,466,742 C8R probably benign Het
Spdye4b C A 5: 143,202,093 S167R possibly damaging Het
Strip1 T C 3: 107,628,221 Y62C possibly damaging Het
Sucla2 A T 14: 73,581,709 I232F probably benign Het
Sugp1 A G 8: 70,069,524 D437G possibly damaging Het
Taf1a A G 1: 183,396,084 probably benign Het
Tbc1d20 T A 2: 152,311,363 M271K probably damaging Het
Tecpr2 T C 12: 110,933,318 S707P probably benign Het
Tert G A 13: 73,647,985 R1017H probably benign Het
Tox C G 4: 6,688,886 V493L probably damaging Het
Tpo C T 12: 30,103,969 A246T probably benign Het
Traf7 A T 17: 24,511,639 V358D probably damaging Het
Trim56 C T 5: 137,112,674 V663M possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usf3 C T 16: 44,220,682 H1842Y probably damaging Het
Uvrag T C 7: 98,888,461 E509G probably benign Het
Vmn2r5 T C 3: 64,503,971 D305G possibly damaging Het
Vmn2r52 T C 7: 10,169,131 R457G probably damaging Het
Vti1a A C 19: 55,380,979 N101T possibly damaging Het
Zfp236 A G 18: 82,668,637 F259L probably benign Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2008:Prdm2 UTSW 4 143134947 missense probably damaging 1.00
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7968:Prdm2 UTSW 4 143134570 missense probably benign 0.41
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTGTTGGTCTGAATCTTACCATC -3'
(R):5'- TGAGTCGAGTCCACCTCAAC -3'

Sequencing Primer
(F):5'- CTCTGTGCTTGGTACATAGA -3'
(R):5'- CCTCAACTTGGGCAAGACTGTTTG -3'
Posted On2014-12-04