Mutagenetix > Incidental Mutations

Incidental Mutation 'R2679:Itga3'

250797

Institutional Source

Beutler Lab

Gene Symbol

Itga3

Ensembl Gene

ENSMUSG00000001507

Gene Name

integrin alpha 3

Synonyms

VLA-3 alpha 3, alpha3-integrin

MMRRC Submission

040432-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2679 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95044474-95076801 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 95068310 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001548] [ENSMUST00000107739] [ENSMUST00000120375]

Predicted Effect

probably benign
Transcript: ENSMUST00000001548

SMART Domains

Protein: ENSMUSP00000001548
Gene: ENSMUSG00000001507

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	7e-54	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107739

SMART Domains

Protein: ENSMUSP00000103368
Gene: ENSMUSG00000001507

Domain	Start	End	E-Value	Type
Int_alpha	20	79	1.05e2	SMART
Int_alpha	215	269	5.01e0	SMART
Int_alpha	273	330	3.07e-14	SMART
Int_alpha	335	388	4.17e-16	SMART
Int_alpha	396	452	7.57e1	SMART
low complexity region	490	503	N/A	INTRINSIC
low complexity region	775	789	N/A	INTRINSIC
transmembrane domain	963	985	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000120375

SMART Domains

Protein: ENSMUSP00000113556
Gene: ENSMUSG00000001507

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
Int_alpha	48	110	4.18e-7	SMART
Int_alpha	246	300	5.01e0	SMART
Int_alpha	304	361	3.07e-14	SMART
Int_alpha	366	419	4.17e-16	SMART
Int_alpha	427	483	7.57e1	SMART
low complexity region	521	534	N/A	INTRINSIC
SCOP:d1m1xa3	758	984	2e-53	SMART
transmembrane domain	994	1016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145671

SMART Domains

Protein: ENSMUSP00000115970
Gene: ENSMUSG00000001507

Domain	Start	End	E-Value	Type
Blast:Int_alpha	6	52	3e-22	BLAST
SCOP:d1m1xa4	8	182	3e-24	SMART
PDB:4IRZ\|A	12	168	2e-8	PDB
Blast:Int_alpha	55	88	2e-6	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: This gene encodes a subunit of integrin family of cell surface proteins. The encoded protein undergoes post-translational processing to form a disulfide bond-linked dimer comprised of heavy and light chains. At the cell surface, the encoded protein non-covalently associates with the integrin beta-1 subunit to form a heterodimer that interacts with many extracellular matrix proteins including fibronectin and laminin. Mice lacking the encoded protein die during the first day after birth due to severe abnormalities in kidneys. Mice lacking the encoded protein specifically in the basal layer of epidermis display several skin defects and accelerated wound healing. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the kidney and submandibular gland, decreased bronchial branching of the lungs, skin blisters at the dermal-epidermal junction, abnormal layering of the cerebral cortex and perinatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic2	A	G	11: 81,151,954	V171A	probably benign	Het
Atf7ip	A	T	6: 136,566,651	I641L	possibly damaging	Het
Atrn	G	A	2: 130,961,675		probably null	Het
Bpifb4	T	C	2: 153,948,624	I145T	probably damaging	Het
Bub3	A	G	7: 131,568,725		probably null	Het
Catsperb	T	A	12: 101,463,145	D192E	probably damaging	Het
Ccdc178	G	A	18: 21,811,556	H849Y	possibly damaging	Het
Cd101	G	T	3: 100,993,763	Q998K	probably benign	Het
Cep135	A	T	5: 76,624,660	M631L	probably benign	Het
Cit	T	C	5: 115,969,115	V1102A	probably benign	Het
Col4a4	G	A	1: 82,529,611	T249M	unknown	Het
Cpne6	A	T	14: 55,516,329	I415F	possibly damaging	Het
Cyp4b1	T	C	4: 115,628,697	I348V	probably benign	Het
Defb28	T	C	2: 152,518,282	S6P	possibly damaging	Het
Dhrs7b	A	G	11: 60,852,518		probably benign	Het
Dhx29	T	C	13: 112,947,376		probably null	Het
Egfem1	A	G	3: 29,670,676	T476A	probably benign	Het
Enpp5	A	G	17: 44,085,388	D397G	probably damaging	Het
Eogt	G	A	6: 97,120,800	T279I	probably benign	Het
Fnip2	G	A	3: 79,480,926	H833Y	probably benign	Het
Gabrr2	A	T	4: 33,071,435	T92S	probably damaging	Het
Gm10110	T	A	14: 89,897,416		noncoding transcript	Het
Gm4778	A	T	3: 94,265,910	Y75F	probably damaging	Het
Gria2	A	G	3: 80,740,953		probably benign	Het
Hmcn1	G	T	1: 150,652,575	T3274N	possibly damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspa1b	T	C	17: 34,957,303	K569E	probably benign	Het
Ighv1-82	T	C	12: 115,952,752	Y46C	probably damaging	Het
Lrrc7	T	A	3: 158,175,108	R552*	probably null	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Muc4	T	A	16: 32,757,472	D2374E	unknown	Het
Myl9	T	A	2: 156,780,506	L70Q	probably damaging	Het
Nebl	C	T	2: 17,424,591	S243N	probably benign	Het
Nfat5	A	G	8: 107,344,914	Y314C	probably damaging	Het
Nr2f6	T	A	8: 71,374,736	D307V	probably damaging	Het
Nrp2	T	C	1: 62,785,078	S781P	probably benign	Het
Nub1	C	T	5: 24,692,925	T103I	possibly damaging	Het
Olfr32	A	T	2: 90,138,545	V198D	possibly damaging	Het
Olfr572	T	A	7: 102,928,031	Y134*	probably null	Het
Pex5l	A	T	3: 33,082,052	M6K	probably benign	Het
Pgm3	A	C	9: 86,569,321	C93W	probably benign	Het
Pkhd1	A	G	1: 20,209,182	S2971P	probably benign	Het
Pkhd1l1	T	C	15: 44,545,386	L2423P	probably damaging	Het
Prkce	A	G	17: 86,176,226		probably benign	Het
Ptbp3	A	G	4: 59,494,615		probably benign	Het
Ptgis	T	A	2: 167,208,193	M339L	probably benign	Het
Pxdn	T	C	12: 29,975,569		probably benign	Het
Rab44	T	A	17: 29,144,477		probably null	Het
Ric1	A	G	19: 29,604,030	S1275G	probably benign	Het
Rnf213	C	A	11: 119,459,938		probably null	Het
Rtn4rl1	A	T	11: 75,265,726	E328V	probably benign	Het
Saraf	C	T	8: 34,165,274	T169I	probably damaging	Het
Sbk2	T	A	7: 4,957,120		probably null	Het
Setd1a	T	G	7: 127,795,724		probably benign	Het
Sit1	A	G	4: 43,483,157	Y73H	probably damaging	Het
Slc44a4	T	C	17: 34,923,423		probably benign	Het
Tas2r125	A	G	6: 132,910,227	T193A	probably benign	Het
Tbc1d9b	T	A	11: 50,161,701		probably null	Het
Tcf7l1	G	T	6: 72,627,420	H580Q	probably benign	Het
Tead1	T	G	7: 112,856,846	S115A	probably damaging	Het
Top2b	G	A	14: 16,413,947	G29D	probably damaging	Het
Trpv4	A	T	5: 114,635,552	C250S	probably damaging	Het
U2surp	A	C	9: 95,476,232	I655S	possibly damaging	Het
Ube2a	G	A	X: 36,874,707		probably benign	Het
Ubl7	A	G	9: 57,914,599	D77G	probably damaging	Het
Vmn1r91	T	C	7: 20,102,058	C301R	probably damaging	Het
Vmn2r90	A	T	17: 17,712,869	R230S	possibly damaging	Het
Wdfy3	T	A	5: 101,870,036	E2560V	probably damaging	Het
Zfp273	C	T	13: 67,825,776	A341V	probably benign	Het
Zfp512	C	T	5: 31,465,454	A33V	probably benign	Het

Other mutations in Itga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Itga3	APN	11	95065886	missense	probably damaging	1.00
IGL02020:Itga3	APN	11	95057390	missense	probably benign	0.02
IGL02413:Itga3	APN	11	95068771	missense	probably damaging	1.00
IGL02562:Itga3	APN	11	95068793	missense	probably benign	0.02
PIT4508001:Itga3	UTSW	11	95055893	missense	probably benign	0.20
R0485:Itga3	UTSW	11	95061970	missense	probably benign	0.05
R1548:Itga3	UTSW	11	95046919	critical splice donor site	probably null
R1677:Itga3	UTSW	11	95055759	missense	probably damaging	0.96
R2062:Itga3	UTSW	11	95054076	missense	possibly damaging	0.92
R2088:Itga3	UTSW	11	95052494	missense	probably benign	0.10
R3697:Itga3	UTSW	11	95062725	missense	probably benign	0.00
R3839:Itga3	UTSW	11	95057269	critical splice donor site	probably null
R4210:Itga3	UTSW	11	95062623	missense	probably benign	0.00
R4533:Itga3	UTSW	11	95057293	missense	probably benign	0.15
R4849:Itga3	UTSW	11	95076271	missense	probably benign
R4863:Itga3	UTSW	11	95061967	missense	probably damaging	1.00
R4889:Itga3	UTSW	11	95068301	missense	probably benign	0.13
R5218:Itga3	UTSW	11	95062748	missense	probably benign	0.01
R6046:Itga3	UTSW	11	95062715	missense	probably benign	0.28
R6087:Itga3	UTSW	11	95052443	critical splice donor site	probably null
R6210:Itga3	UTSW	11	95068891	intron	probably benign
R6341:Itga3	UTSW	11	95055851	splice site	probably null
R6666:Itga3	UTSW	11	95065826	missense	probably benign	0.00
R6998:Itga3	UTSW	11	95051462	missense	probably benign	0.00
R7106:Itga3	UTSW	11	95055873	missense	probably benign	0.00
R7164:Itga3	UTSW	11	95052479	missense	possibly damaging	0.85
R7267:Itga3	UTSW	11	95076362	intron	probably benign
R7421:Itga3	UTSW	11	95068855	missense	probably benign	0.20
R7514:Itga3	UTSW	11	95065896	nonsense	probably null
R7533:Itga3	UTSW	11	95046518	missense	probably benign	0.45
R7736:Itga3	UTSW	11	95076203	missense	probably damaging	1.00
R8145:Itga3	UTSW	11	95052464	missense	probably damaging	1.00
R8303:Itga3	UTSW	11	95062640	missense	probably benign	0.42
R8459:Itga3	UTSW	11	95068807	missense	probably benign
R8464:Itga3	UTSW	11	95062740	missense	probably benign	0.28
Z1177:Itga3	UTSW	11	95056774	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGCCCCAGTCATCAGTG -3'
(R):5'- TGTGAACGGATGGACATTTCAG -3'

Sequencing Primer
(F):5'- AGTCATCAGTGGATCCCCG -3'
(R):5'- CAAGGCTAGATCTACTATGGGCTAC -3'

Posted On

2014-12-04