Incidental Mutation 'R2679:Zfp273'
ID250812
Institutional Source Beutler Lab
Gene Symbol Zfp273
Ensembl Gene ENSMUSG00000030446
Gene Namezinc finger protein 273
Synonyms6820416H06Rik
MMRRC Submission 040432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2679 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location67813740-67827002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67825776 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 341 (A341V)
Ref Sequence ENSEMBL: ENSMUSP00000137903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012725] [ENSMUST00000181391]
Predicted Effect probably benign
Transcript: ENSMUST00000012725
AA Change: A308V

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000012725
Gene: ENSMUSG00000030446
AA Change: A308V

DomainStartEndE-ValueType
KRAB 1 32 1.97e-1 SMART
ZnF_C2H2 48 70 1.95e-3 SMART
ZnF_C2H2 76 98 4.94e-5 SMART
ZnF_C2H2 104 126 6.32e-3 SMART
ZnF_C2H2 132 154 3.39e-3 SMART
ZnF_C2H2 160 182 2.99e-4 SMART
ZnF_C2H2 188 210 4.24e-4 SMART
ZnF_C2H2 216 238 1.45e-2 SMART
ZnF_C2H2 244 266 1.1e-2 SMART
ZnF_C2H2 272 294 2.91e-2 SMART
ZnF_C2H2 300 322 6.78e-3 SMART
ZnF_C2H2 328 350 2.71e-2 SMART
ZnF_C2H2 356 378 4.17e-3 SMART
ZnF_C2H2 384 406 1.38e-3 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 1.2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181391
AA Change: A341V

PolyPhen 2 Score 0.390 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000137903
Gene: ENSMUSG00000030446
AA Change: A341V

DomainStartEndE-ValueType
KRAB 5 65 9.25e-28 SMART
ZnF_C2H2 81 103 1.95e-3 SMART
ZnF_C2H2 109 131 4.94e-5 SMART
ZnF_C2H2 137 159 6.32e-3 SMART
ZnF_C2H2 165 187 3.39e-3 SMART
ZnF_C2H2 193 215 2.99e-4 SMART
ZnF_C2H2 221 243 4.24e-4 SMART
ZnF_C2H2 249 271 1.45e-2 SMART
ZnF_C2H2 277 299 1.1e-2 SMART
ZnF_C2H2 305 327 2.91e-2 SMART
ZnF_C2H2 333 355 6.78e-3 SMART
ZnF_C2H2 361 383 2.71e-2 SMART
ZnF_C2H2 389 411 4.17e-3 SMART
ZnF_C2H2 417 439 1.38e-3 SMART
ZnF_C2H2 445 467 1.98e-4 SMART
ZnF_C2H2 473 495 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181912
Meta Mutation Damage Score 0.2740 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 97% (67/69)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asic2 A G 11: 81,151,954 V171A probably benign Het
Atf7ip A T 6: 136,566,651 I641L possibly damaging Het
Atrn G A 2: 130,961,675 probably null Het
Bpifb4 T C 2: 153,948,624 I145T probably damaging Het
Bub3 A G 7: 131,568,725 probably null Het
Catsperb T A 12: 101,463,145 D192E probably damaging Het
Ccdc178 G A 18: 21,811,556 H849Y possibly damaging Het
Cd101 G T 3: 100,993,763 Q998K probably benign Het
Cep135 A T 5: 76,624,660 M631L probably benign Het
Cit T C 5: 115,969,115 V1102A probably benign Het
Col4a4 G A 1: 82,529,611 T249M unknown Het
Cpne6 A T 14: 55,516,329 I415F possibly damaging Het
Cyp4b1 T C 4: 115,628,697 I348V probably benign Het
Defb28 T C 2: 152,518,282 S6P possibly damaging Het
Dhrs7b A G 11: 60,852,518 probably benign Het
Dhx29 T C 13: 112,947,376 probably null Het
Egfem1 A G 3: 29,670,676 T476A probably benign Het
Enpp5 A G 17: 44,085,388 D397G probably damaging Het
Eogt G A 6: 97,120,800 T279I probably benign Het
Fnip2 G A 3: 79,480,926 H833Y probably benign Het
Gabrr2 A T 4: 33,071,435 T92S probably damaging Het
Gm10110 T A 14: 89,897,416 noncoding transcript Het
Gm4778 A T 3: 94,265,910 Y75F probably damaging Het
Gria2 A G 3: 80,740,953 probably benign Het
Hmcn1 G T 1: 150,652,575 T3274N possibly damaging Het
Hnrnpul1 C T 7: 25,726,875 R517Q probably damaging Het
Hspa1b T C 17: 34,957,303 K569E probably benign Het
Ighv1-82 T C 12: 115,952,752 Y46C probably damaging Het
Itga3 A T 11: 95,068,310 probably benign Het
Lrrc7 T A 3: 158,175,108 R552* probably null Het
Med13 A G 11: 86,298,577 S1169P probably benign Het
Muc4 T A 16: 32,757,472 D2374E unknown Het
Myl9 T A 2: 156,780,506 L70Q probably damaging Het
Nebl C T 2: 17,424,591 S243N probably benign Het
Nfat5 A G 8: 107,344,914 Y314C probably damaging Het
Nr2f6 T A 8: 71,374,736 D307V probably damaging Het
Nrp2 T C 1: 62,785,078 S781P probably benign Het
Nub1 C T 5: 24,692,925 T103I possibly damaging Het
Olfr32 A T 2: 90,138,545 V198D possibly damaging Het
Olfr572 T A 7: 102,928,031 Y134* probably null Het
Pex5l A T 3: 33,082,052 M6K probably benign Het
Pgm3 A C 9: 86,569,321 C93W probably benign Het
Pkhd1 A G 1: 20,209,182 S2971P probably benign Het
Pkhd1l1 T C 15: 44,545,386 L2423P probably damaging Het
Prkce A G 17: 86,176,226 probably benign Het
Ptbp3 A G 4: 59,494,615 probably benign Het
Ptgis T A 2: 167,208,193 M339L probably benign Het
Pxdn T C 12: 29,975,569 probably benign Het
Rab44 T A 17: 29,144,477 probably null Het
Ric1 A G 19: 29,604,030 S1275G probably benign Het
Rnf213 C A 11: 119,459,938 probably null Het
Rtn4rl1 A T 11: 75,265,726 E328V probably benign Het
Saraf C T 8: 34,165,274 T169I probably damaging Het
Sbk2 T A 7: 4,957,120 probably null Het
Setd1a T G 7: 127,795,724 probably benign Het
Sit1 A G 4: 43,483,157 Y73H probably damaging Het
Slc44a4 T C 17: 34,923,423 probably benign Het
Tas2r125 A G 6: 132,910,227 T193A probably benign Het
Tbc1d9b T A 11: 50,161,701 probably null Het
Tcf7l1 G T 6: 72,627,420 H580Q probably benign Het
Tead1 T G 7: 112,856,846 S115A probably damaging Het
Top2b G A 14: 16,413,947 G29D probably damaging Het
Trpv4 A T 5: 114,635,552 C250S probably damaging Het
U2surp A C 9: 95,476,232 I655S possibly damaging Het
Ube2a G A X: 36,874,707 probably benign Het
Ubl7 A G 9: 57,914,599 D77G probably damaging Het
Vmn1r91 T C 7: 20,102,058 C301R probably damaging Het
Vmn2r90 A T 17: 17,712,869 R230S possibly damaging Het
Wdfy3 T A 5: 101,870,036 E2560V probably damaging Het
Zfp512 C T 5: 31,465,454 A33V probably benign Het
Other mutations in Zfp273
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03115:Zfp273 APN 13 67825650 missense probably damaging 1.00
R1969:Zfp273 UTSW 13 67825163 missense probably damaging 1.00
R3736:Zfp273 UTSW 13 67825507 nonsense probably null
R4832:Zfp273 UTSW 13 67825365 missense probably benign 0.01
R4896:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5004:Zfp273 UTSW 13 67825554 missense probably damaging 1.00
R5223:Zfp273 UTSW 13 67826179 missense probably damaging 1.00
R5748:Zfp273 UTSW 13 67825331 missense probably damaging 1.00
R5948:Zfp273 UTSW 13 67825799 missense probably benign 0.43
R6102:Zfp273 UTSW 13 67822347 missense probably damaging 1.00
R6668:Zfp273 UTSW 13 67825124 missense probably damaging 0.99
R7192:Zfp273 UTSW 13 67825064 missense possibly damaging 0.82
R7478:Zfp273 UTSW 13 67825132 missense probably benign 0.30
R7792:Zfp273 UTSW 13 67826016 missense possibly damaging 0.71
R7874:Zfp273 UTSW 13 67825439 missense probably benign 0.00
R8261:Zfp273 UTSW 13 67825951 missense probably benign 0.12
R8424:Zfp273 UTSW 13 67822352 missense probably benign 0.17
X0028:Zfp273 UTSW 13 67823142 missense probably benign 0.20
Z1088:Zfp273 UTSW 13 67825394 missense possibly damaging 0.91
Z1176:Zfp273 UTSW 13 67823146 missense probably null
Predicted Primers PCR Primer
(F):5'- CCAGCGAACTCATACTGGGG -3'
(R):5'- AGGCTTTGCAACATGGTTGT -3'

Sequencing Primer
(F):5'- CTCATACTGGGGAGAAACCGTAC -3'
(R):5'- AAGGCTTCTCACCAGTATGGAGTC -3'
Posted On2014-12-04