Mutagenetix > Incidental Mutation

Incidental Mutation 'R2484:Itpr1'

250813

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

040408-MU

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.839) question?

Stock #

R2484 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108369110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 125 (S125P)

Ref Sequence

ENSEMBL: ENSMUSP00000145526 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000203936]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032192
AA Change: S366P

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: S366P

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203615
AA Change: S366P

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: S366P

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203936
AA Change: S125P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000145526
Gene: ENSMUSG00000030102
AA Change: S125P

Domain	Start	End	E-Value	Type
MIR	5	61	1.3e-11	SMART
MIR	68	162	1.6e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203995

Meta Mutation Damage Score

0.5641

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (72/74)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	A	G	17: 56,882,641	N252S	probably benign	Het
4932414N04Rik	G	A	2: 68,711,475	D46N	possibly damaging	Het
A830018L16Rik	G	T	1: 11,596,302	A278S	probably damaging	Het
Adarb2	A	T	13: 8,569,774	K99*	probably null	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atxn1l	A	G	8: 109,732,251	S460P	probably damaging	Het
Bicra	T	A	7: 15,988,680	N304I	possibly damaging	Het
Capn10	A	T	1: 92,944,843	D470V	probably damaging	Het
Chchd3	A	G	6: 32,804,015	Y184H	possibly damaging	Het
Col6a6	T	C	9: 105,780,804	I736M	probably damaging	Het
Dhx36	T	A	3: 62,472,815	N820I	probably damaging	Het
Drd4	C	T	7: 141,294,736	P347S	probably benign	Het
Ephx1	A	T	1: 180,989,972	V378D	probably damaging	Het
Extl3	A	T	14: 65,075,735	V666E	probably damaging	Het
Fam20c	G	C	5: 138,809,117	R500S	probably benign	Het
Glod4	A	T	11: 76,239,518	D42E	probably damaging	Het
Golga2	T	C	2: 32,304,770	I643T	probably benign	Het
Hnf1b	A	T	11: 83,861,835	T73S	probably benign	Het
Hydin	A	G	8: 110,513,115	Y2009C	possibly damaging	Het
Ido2	A	G	8: 24,533,815	C336R	probably damaging	Het
Ifngr1	T	C	10: 19,601,415	V108A	probably damaging	Het
Igbp1b	A	T	6: 138,657,494	N317K	probably benign	Het
Ints14	A	G	9: 64,986,084	S511G	probably benign	Het
Jag1	T	C	2: 137,084,700	T975A	possibly damaging	Het
Klra17	A	G	6: 129,868,757	W165R	probably damaging	Het
Leo1	T	A	9: 75,445,473	N99K	possibly damaging	Het
Lonp1	C	A	17: 56,614,659	G883C	probably damaging	Het
Lpin1	C	A	12: 16,547,499	G682W	probably damaging	Het
Macf1	A	C	4: 123,473,672	L2432R	probably damaging	Het
Med12l	T	G	3: 59,297,838	I2075M	probably benign	Het
Mroh6	A	G	15: 75,884,328	S660P	probably benign	Het
Myh6	G	T	14: 54,961,242	Y309*	probably null	Het
Myof	C	T	19: 37,903,843	R1154H	probably benign	Het
Myrip	G	A	9: 120,424,619	E253K	probably benign	Het
Ndst3	T	C	3: 123,552,537	D281G	possibly damaging	Het
Nipbl	T	C	15: 8,323,698	K1788R	probably damaging	Het
Nol12	A	G	15: 78,940,517		probably benign	Het
Nptn	A	G	9: 58,643,673	T212A	possibly damaging	Het
Nptx2	C	T	5: 144,556,345	A414V	probably damaging	Het
Nub1	A	G	5: 24,708,702	D503G	possibly damaging	Het
Obscn	T	A	11: 59,007,540		probably benign	Het
Olfr1253	A	G	2: 89,752,234	I198T	probably benign	Het
Olfr1447	C	T	19: 12,901,641	M46I	probably benign	Het
Olfr635	A	G	7: 103,979,338	T49A	probably benign	Het
Pcnx2	T	C	8: 125,891,120	E132G	probably damaging	Het
Pkdcc	A	G	17: 83,222,238		probably benign	Het
Prdm2	T	A	4: 143,135,206	I505F	probably damaging	Het
Psmc3	C	G	2: 91,056,001	Q169E	probably damaging	Het
Ptger4	A	T	15: 5,235,173	I334N	probably benign	Het
Ptrh1	T	C	2: 32,777,171	M161T	probably benign	Het
Rapgef6	T	A	11: 54,642,756	V482D	possibly damaging	Het
Rdh16f2	T	C	10: 127,875,077	S188P	probably damaging	Het
Rrh	T	C	3: 129,822,391	Y31C	probably damaging	Het
Selp	G	T	1: 164,143,954	W659L	probably benign	Het
Selp	G	T	1: 164,143,955	W659C	probably damaging	Het
Shh	A	G	5: 28,466,742	C8R	probably benign	Het
Spdye4b	C	A	5: 143,202,093	S167R	possibly damaging	Het
Strip1	T	C	3: 107,628,221	Y62C	possibly damaging	Het
Sucla2	A	T	14: 73,581,709	I232F	probably benign	Het
Sugp1	A	G	8: 70,069,524	D437G	possibly damaging	Het
Taf1a	A	G	1: 183,396,084		probably benign	Het
Tbc1d20	T	A	2: 152,311,363	M271K	probably damaging	Het
Tecpr2	T	C	12: 110,933,318	S707P	probably benign	Het
Tert	G	A	13: 73,647,985	R1017H	probably benign	Het
Tox	C	G	4: 6,688,886	V493L	probably damaging	Het
Tpo	C	T	12: 30,103,969	A246T	probably benign	Het
Traf7	A	T	17: 24,511,639	V358D	probably damaging	Het
Trim56	C	T	5: 137,112,674	V663M	possibly damaging	Het
Unc80	C	T	1: 66,521,581	H823Y	possibly damaging	Het
Usf3	C	T	16: 44,220,682	H1842Y	probably damaging	Het
Uvrag	T	C	7: 98,888,461	E509G	probably benign	Het
Vmn2r5	T	C	3: 64,503,971	D305G	possibly damaging	Het
Vmn2r52	T	C	7: 10,169,131	R457G	probably damaging	Het
Vti1a	A	C	19: 55,380,979	N101T	possibly damaging	Het
Zfp236	A	G	18: 82,668,637	F259L	probably benign	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9710:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGAAACCGGACCTTCTCC -3'
(R):5'- AAGGCTGATTCACTACCTCTTC -3'

Sequencing Primer
(F):5'- AGCCGCTGACACTCACTG -3'
(R):5'- CATAAGTGCTTCGGTTAAAGTCC -3'

Posted On

2014-12-04