Mutagenetix > Incidental Mutations

Incidental Mutation 'R2679:Dhx29'

250814

Institutional Source

Beutler Lab

Gene Symbol

Dhx29

Ensembl Gene

ENSMUSG00000042426

Gene Name

DEAH (Asp-Glu-Ala-His) box polypeptide 29

Synonyms

E130202M19Rik

MMRRC Submission

040432-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2679 (G1)

Quality Score

202

Status

Validated

Chromosome

Chromosomal Location

112927454-112969432 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 112947376 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000035244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038574]

Predicted Effect

probably null
Transcript: ENSMUST00000038574

SMART Domains

Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426

Domain	Start	End	E-Value	Type
low complexity region	10	36	N/A	INTRINSIC
low complexity region	41	54	N/A	INTRINSIC
low complexity region	209	225	N/A	INTRINSIC
low complexity region	240	255	N/A	INTRINSIC
coiled coil region	279	308	N/A	INTRINSIC
low complexity region	343	358	N/A	INTRINSIC
Blast:DEXDc	411	450	2e-14	BLAST
DEXDc	569	763	1.09e-27	SMART
low complexity region	846	856	N/A	INTRINSIC
HELICc	880	985	6.1e-17	SMART
HA2	1047	1138	8.9e-26	SMART
Pfam:OB_NTP_bind	1178	1298	3.8e-19	PFAM

Meta Mutation Damage Score

0.9596

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

97% (67/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Asic2	A	G	11: 81,151,954	V171A	probably benign	Het
Atf7ip	A	T	6: 136,566,651	I641L	possibly damaging	Het
Atrn	G	A	2: 130,961,675		probably null	Het
Bpifb4	T	C	2: 153,948,624	I145T	probably damaging	Het
Bub3	A	G	7: 131,568,725		probably null	Het
Catsperb	T	A	12: 101,463,145	D192E	probably damaging	Het
Ccdc178	G	A	18: 21,811,556	H849Y	possibly damaging	Het
Cd101	G	T	3: 100,993,763	Q998K	probably benign	Het
Cep135	A	T	5: 76,624,660	M631L	probably benign	Het
Cit	T	C	5: 115,969,115	V1102A	probably benign	Het
Col4a4	G	A	1: 82,529,611	T249M	unknown	Het
Cpne6	A	T	14: 55,516,329	I415F	possibly damaging	Het
Cyp4b1	T	C	4: 115,628,697	I348V	probably benign	Het
Defb28	T	C	2: 152,518,282	S6P	possibly damaging	Het
Dhrs7b	A	G	11: 60,852,518		probably benign	Het
Egfem1	A	G	3: 29,670,676	T476A	probably benign	Het
Enpp5	A	G	17: 44,085,388	D397G	probably damaging	Het
Eogt	G	A	6: 97,120,800	T279I	probably benign	Het
Fnip2	G	A	3: 79,480,926	H833Y	probably benign	Het
Gabrr2	A	T	4: 33,071,435	T92S	probably damaging	Het
Gm10110	T	A	14: 89,897,416		noncoding transcript	Het
Gm4778	A	T	3: 94,265,910	Y75F	probably damaging	Het
Gria2	A	G	3: 80,740,953		probably benign	Het
Hmcn1	G	T	1: 150,652,575	T3274N	possibly damaging	Het
Hnrnpul1	C	T	7: 25,726,875	R517Q	probably damaging	Het
Hspa1b	T	C	17: 34,957,303	K569E	probably benign	Het
Ighv1-82	T	C	12: 115,952,752	Y46C	probably damaging	Het
Itga3	A	T	11: 95,068,310		probably benign	Het
Lrrc7	T	A	3: 158,175,108	R552*	probably null	Het
Med13	A	G	11: 86,298,577	S1169P	probably benign	Het
Muc4	T	A	16: 32,757,472	D2374E	unknown	Het
Myl9	T	A	2: 156,780,506	L70Q	probably damaging	Het
Nebl	C	T	2: 17,424,591	S243N	probably benign	Het
Nfat5	A	G	8: 107,344,914	Y314C	probably damaging	Het
Nr2f6	T	A	8: 71,374,736	D307V	probably damaging	Het
Nrp2	T	C	1: 62,785,078	S781P	probably benign	Het
Nub1	C	T	5: 24,692,925	T103I	possibly damaging	Het
Olfr32	A	T	2: 90,138,545	V198D	possibly damaging	Het
Olfr572	T	A	7: 102,928,031	Y134*	probably null	Het
Pex5l	A	T	3: 33,082,052	M6K	probably benign	Het
Pgm3	A	C	9: 86,569,321	C93W	probably benign	Het
Pkhd1	A	G	1: 20,209,182	S2971P	probably benign	Het
Pkhd1l1	T	C	15: 44,545,386	L2423P	probably damaging	Het
Prkce	A	G	17: 86,176,226		probably benign	Het
Ptbp3	A	G	4: 59,494,615		probably benign	Het
Ptgis	T	A	2: 167,208,193	M339L	probably benign	Het
Pxdn	T	C	12: 29,975,569		probably benign	Het
Rab44	T	A	17: 29,144,477		probably null	Het
Ric1	A	G	19: 29,604,030	S1275G	probably benign	Het
Rnf213	C	A	11: 119,459,938		probably null	Het
Rtn4rl1	A	T	11: 75,265,726	E328V	probably benign	Het
Saraf	C	T	8: 34,165,274	T169I	probably damaging	Het
Sbk2	T	A	7: 4,957,120		probably null	Het
Setd1a	T	G	7: 127,795,724		probably benign	Het
Sit1	A	G	4: 43,483,157	Y73H	probably damaging	Het
Slc44a4	T	C	17: 34,923,423		probably benign	Het
Tas2r125	A	G	6: 132,910,227	T193A	probably benign	Het
Tbc1d9b	T	A	11: 50,161,701		probably null	Het
Tcf7l1	G	T	6: 72,627,420	H580Q	probably benign	Het
Tead1	T	G	7: 112,856,846	S115A	probably damaging	Het
Top2b	G	A	14: 16,413,947	G29D	probably damaging	Het
Trpv4	A	T	5: 114,635,552	C250S	probably damaging	Het
U2surp	A	C	9: 95,476,232	I655S	possibly damaging	Het
Ube2a	G	A	X: 36,874,707		probably benign	Het
Ubl7	A	G	9: 57,914,599	D77G	probably damaging	Het
Vmn1r91	T	C	7: 20,102,058	C301R	probably damaging	Het
Vmn2r90	A	T	17: 17,712,869	R230S	possibly damaging	Het
Wdfy3	T	A	5: 101,870,036	E2560V	probably damaging	Het
Zfp273	C	T	13: 67,825,776	A341V	probably benign	Het
Zfp512	C	T	5: 31,465,454	A33V	probably benign	Het

Other mutations in Dhx29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Dhx29	APN	13	112964603	missense	probably benign	0.15
IGL00434:Dhx29	APN	13	112955225	missense	probably benign	0.00
IGL00659:Dhx29	APN	13	112966635	splice site	probably benign
IGL01618:Dhx29	APN	13	112965222	missense	probably damaging	1.00
IGL01777:Dhx29	APN	13	112930872	missense	probably benign	0.42
IGL02010:Dhx29	APN	13	112966634	critical splice donor site	probably null
IGL02125:Dhx29	APN	13	112955300	splice site	probably benign
IGL02324:Dhx29	APN	13	112927808	missense	probably damaging	1.00
IGL02801:Dhx29	APN	13	112964646	missense	probably damaging	1.00
R0001:Dhx29	UTSW	13	112964556	missense	probably damaging	0.99
R0362:Dhx29	UTSW	13	112962859	missense	probably benign
R0468:Dhx29	UTSW	13	112963277	missense	probably benign
R0569:Dhx29	UTSW	13	112948214	missense	probably benign	0.01
R0714:Dhx29	UTSW	13	112927965	missense	possibly damaging	0.55
R1460:Dhx29	UTSW	13	112965210	splice site	probably benign
R1579:Dhx29	UTSW	13	112935598	critical splice donor site	probably null
R1657:Dhx29	UTSW	13	112952843	missense	probably damaging	1.00
R1735:Dhx29	UTSW	13	112945086	missense	probably benign	0.00
R1768:Dhx29	UTSW	13	112948240	missense	probably damaging	1.00
R1851:Dhx29	UTSW	13	112948281	missense	probably damaging	1.00
R1937:Dhx29	UTSW	13	112965330	missense	probably benign	0.06
R2180:Dhx29	UTSW	13	112962872	critical splice donor site	probably null
R2219:Dhx29	UTSW	13	112952804	missense	probably damaging	1.00
R2442:Dhx29	UTSW	13	112946974	missense	possibly damaging	0.94
R2908:Dhx29	UTSW	13	112927851	missense	possibly damaging	0.78
R2912:Dhx29	UTSW	13	112935575	missense	probably damaging	1.00
R3414:Dhx29	UTSW	13	112947273	missense	probably damaging	0.99
R3931:Dhx29	UTSW	13	112958965	missense	probably damaging	1.00
R3957:Dhx29	UTSW	13	112930921	missense	probably benign
R4065:Dhx29	UTSW	13	112964742	critical splice donor site	probably null
R4207:Dhx29	UTSW	13	112927949	missense	probably benign	0.01
R4422:Dhx29	UTSW	13	112947247	missense	probably damaging	1.00
R4717:Dhx29	UTSW	13	112946935	missense	unknown
R4718:Dhx29	UTSW	13	112946935	missense	unknown
R5125:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5178:Dhx29	UTSW	13	112932600	missense	possibly damaging	0.81
R5263:Dhx29	UTSW	13	112948221	missense	probably damaging	1.00
R5458:Dhx29	UTSW	13	112966621	missense	probably benign	0.00
R5469:Dhx29	UTSW	13	112944539	missense	possibly damaging	0.94
R5541:Dhx29	UTSW	13	112940374	missense	possibly damaging	0.47
R5573:Dhx29	UTSW	13	112933215	missense	probably benign	0.07
R5664:Dhx29	UTSW	13	112946879	missense	probably damaging	1.00
R5682:Dhx29	UTSW	13	112930849	missense	probably damaging	1.00
R5769:Dhx29	UTSW	13	112953717	missense	probably damaging	0.99
R5917:Dhx29	UTSW	13	112962843	missense	probably damaging	1.00
R5928:Dhx29	UTSW	13	112964468	missense	probably benign	0.00
R6115:Dhx29	UTSW	13	112952801	critical splice acceptor site	probably null
R6144:Dhx29	UTSW	13	112964571	missense	probably damaging	1.00
R6195:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6233:Dhx29	UTSW	13	112964537	missense	probably benign	0.08
R6430:Dhx29	UTSW	13	112944619	missense	possibly damaging	0.77
R6480:Dhx29	UTSW	13	112953788	nonsense	probably null
R6527:Dhx29	UTSW	13	112932542	missense	probably damaging	1.00
R6856:Dhx29	UTSW	13	112952861	missense	probably benign	0.43
R7391:Dhx29	UTSW	13	112962859	missense	probably benign
R7555:Dhx29	UTSW	13	112927642	start gained	probably benign
R7602:Dhx29	UTSW	13	112944559	missense	possibly damaging	0.95
Z1177:Dhx29	UTSW	13	112955517	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AAACTCTGAAGAGGCACCGG -3'
(R):5'- TTCCACAGGAAAGACTCAGAAG -3'

Sequencing Primer
(F):5'- TGGTGGTGGTAGCAGGTGAAAC -3'
(R):5'- CTCAGAAGAGACAGTAAGCCG -3'

Posted On

2014-12-04