Incidental Mutation 'R2680:Ercc5'
ID250846
Institutional Source Beutler Lab
Gene Symbol Ercc5
Ensembl Gene ENSMUSG00000026048
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 5
SynonymsXpg
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location44147744-44181260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44156973 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 42 (V42A)
Ref Sequence ENSEMBL: ENSMUSP00000027214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027214]
Predicted Effect probably benign
Transcript: ENSMUST00000027214
AA Change: V42A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027214
Gene: ENSMUSG00000026048
AA Change: V42A

DomainStartEndE-ValueType
XPGN 1 98 3.49e-50 SMART
low complexity region 104 115 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
low complexity region 641 650 N/A INTRINSIC
XPGI 776 845 1.02e-33 SMART
HhH2 847 880 2.94e-11 SMART
low complexity region 1130 1140 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145406
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155862
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-strand specific DNA endonuclease that makes the 3' incision in DNA excision repair following UV-induced damage. The protein may also function in other cellular processes, including RNA polymerase II transcription, and transcription-coupled DNA repair. Mutations in this gene cause xeroderma pigmentosum complementation group G (XP-G), which is also referred to as xeroderma pigmentosum VII (XP7), a skin disorder characterized by hypersensitivity to UV light and increased susceptibility for skin cancer development following UV exposure. Some patients also develop Cockayne syndrome, which is characterized by severe growth defects, mental retardation, and cachexia. Read-through transcription exists between this gene and the neighboring upstream BIVM (basic, immunoglobulin-like variable motif containing) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mice display postnatal mortality, severely retarded postnatal growth, impaired small intestine development, reduced organ size, and hypersensitivity to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Ercc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ercc5 APN 1 44163898 missense probably damaging 1.00
IGL00782:Ercc5 APN 1 44163935 missense probably damaging 1.00
IGL01418:Ercc5 APN 1 44167280 missense probably benign 0.43
IGL01710:Ercc5 APN 1 44164075 missense probably damaging 1.00
IGL02528:Ercc5 APN 1 44167802 missense probably benign 0.00
IGL02589:Ercc5 APN 1 44164049 missense probably damaging 1.00
IGL02651:Ercc5 APN 1 44156944 missense probably damaging 1.00
IGL02740:Ercc5 APN 1 44167492 missense probably benign 0.00
IGL02999:Ercc5 APN 1 44167654 missense probably benign 0.00
IGL03057:Ercc5 APN 1 44167001 missense probably damaging 0.99
IGL03246:Ercc5 APN 1 44167081 missense probably damaging 1.00
R0084:Ercc5 UTSW 1 44175976 missense possibly damaging 0.53
R0448:Ercc5 UTSW 1 44173940 missense probably damaging 1.00
R1120:Ercc5 UTSW 1 44161841 missense probably damaging 1.00
R1312:Ercc5 UTSW 1 44164019 missense probably damaging 1.00
R1411:Ercc5 UTSW 1 44178281 missense probably damaging 0.99
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1462:Ercc5 UTSW 1 44180624 missense probably damaging 0.98
R1528:Ercc5 UTSW 1 44178241 nonsense probably null
R1637:Ercc5 UTSW 1 44167534 missense probably benign 0.00
R1668:Ercc5 UTSW 1 44167033 missense probably benign 0.04
R1714:Ercc5 UTSW 1 44167339 missense probably benign 0.01
R1780:Ercc5 UTSW 1 44167796 missense probably benign 0.17
R1800:Ercc5 UTSW 1 44173380 missense probably benign 0.00
R1835:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1836:Ercc5 UTSW 1 44180875 missense probably benign 0.00
R1886:Ercc5 UTSW 1 44175976 nonsense probably null
R2344:Ercc5 UTSW 1 44167169 missense probably benign
R3033:Ercc5 UTSW 1 44180574 missense possibly damaging 0.83
R3919:Ercc5 UTSW 1 44161931 missense probably damaging 1.00
R3933:Ercc5 UTSW 1 44167856 missense probably benign 0.17
R4444:Ercc5 UTSW 1 44158209 frame shift probably null
R4578:Ercc5 UTSW 1 44148148 missense probably benign 0.32
R4585:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4586:Ercc5 UTSW 1 44158857 missense probably benign 0.36
R4911:Ercc5 UTSW 1 44166871 missense possibly damaging 0.66
R4912:Ercc5 UTSW 1 44157057 missense probably damaging 1.00
R4942:Ercc5 UTSW 1 44175965 missense probably benign 0.09
R5155:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
R5975:Ercc5 UTSW 1 44173406 missense probably benign 0.04
R5991:Ercc5 UTSW 1 44180830 nonsense probably null
R6161:Ercc5 UTSW 1 44167352 missense probably benign 0.00
R6250:Ercc5 UTSW 1 44164049 missense probably damaging 1.00
R7142:Ercc5 UTSW 1 44174214 missense probably damaging 1.00
R7183:Ercc5 UTSW 1 44161808 critical splice acceptor site probably null
R7183:Ercc5 UTSW 1 44161809 critical splice acceptor site probably null
R7235:Ercc5 UTSW 1 44178203 missense possibly damaging 0.68
R7349:Ercc5 UTSW 1 44180908 missense possibly damaging 0.56
R7369:Ercc5 UTSW 1 44180860 missense probably benign 0.39
R7486:Ercc5 UTSW 1 44148064 start codon destroyed probably null 1.00
R7586:Ercc5 UTSW 1 44175851 missense possibly damaging 0.49
R7904:Ercc5 UTSW 1 44175838 critical splice acceptor site probably null
R7994:Ercc5 UTSW 1 44178334 missense possibly damaging 0.94
R8432:Ercc5 UTSW 1 44167681 nonsense probably null
R8795:Ercc5 UTSW 1 44163929 missense possibly damaging 0.92
X0011:Ercc5 UTSW 1 44180622 missense probably damaging 1.00
X0062:Ercc5 UTSW 1 44173974 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACGCTGACTGGCTTATAGAGAG -3'
(R):5'- GCAGACGTACACAAATGGTTAAC -3'

Sequencing Primer
(F):5'- GCTGACTGGCTTATAGAGAGAATTAC -3'
(R):5'- TGGCAGGATTTTGAAGGAGACTG -3'
Posted On2014-12-04