Incidental Mutation 'R2484:Myrip'
ID 250847
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 040408-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2484 (G1)
Quality Score 199
Status Validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 120253685 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 253 (E253K)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121] [ENSMUST00000133173]
AlphaFold Q8K3I4
Predicted Effect probably benign
Transcript: ENSMUST00000048121
AA Change: E253K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: E253K

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129168
Predicted Effect probably benign
Transcript: ENSMUST00000133173
SMART Domains Protein: ENSMUSP00000122046
Gene: ENSMUSG00000041794

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2.1e-44 PFAM
Pfam:Rab_eff_C 152 210 5.4e-34 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000214784
AA Change: E248K
Meta Mutation Damage Score 0.0607 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (72/74)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik G A 2: 68,541,819 (GRCm39) D46N possibly damaging Het
A830018L16Rik G T 1: 11,666,526 (GRCm39) A278S probably damaging Het
Acsbg3 A G 17: 57,189,641 (GRCm39) N252S probably benign Het
Adarb2 A T 13: 8,619,810 (GRCm39) K99* probably null Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atxn1l A G 8: 110,458,883 (GRCm39) S460P probably damaging Het
Bicra T A 7: 15,722,605 (GRCm39) N304I possibly damaging Het
Capn10 A T 1: 92,872,565 (GRCm39) D470V probably damaging Het
Chchd3 A G 6: 32,780,950 (GRCm39) Y184H possibly damaging Het
Col6a6 T C 9: 105,658,003 (GRCm39) I736M probably damaging Het
Dhx36 T A 3: 62,380,236 (GRCm39) N820I probably damaging Het
Drd4 C T 7: 140,874,649 (GRCm39) P347S probably benign Het
Ephx1 A T 1: 180,817,537 (GRCm39) V378D probably damaging Het
Extl3 A T 14: 65,313,184 (GRCm39) V666E probably damaging Het
Fam20c G C 5: 138,794,872 (GRCm39) R500S probably benign Het
Glod4 A T 11: 76,130,344 (GRCm39) D42E probably damaging Het
Golga2 T C 2: 32,194,782 (GRCm39) I643T probably benign Het
Hnf1b A T 11: 83,752,661 (GRCm39) T73S probably benign Het
Hydin A G 8: 111,239,747 (GRCm39) Y2009C possibly damaging Het
Ido2 A G 8: 25,023,831 (GRCm39) C336R probably damaging Het
Ifngr1 T C 10: 19,477,163 (GRCm39) V108A probably damaging Het
Igbp1b A T 6: 138,634,492 (GRCm39) N317K probably benign Het
Ints14 A G 9: 64,893,366 (GRCm39) S511G probably benign Het
Itpr1 T C 6: 108,346,071 (GRCm39) S125P probably damaging Het
Jag1 T C 2: 136,926,620 (GRCm39) T975A possibly damaging Het
Klra17 A G 6: 129,845,720 (GRCm39) W165R probably damaging Het
Leo1 T A 9: 75,352,755 (GRCm39) N99K possibly damaging Het
Lonp1 C A 17: 56,921,659 (GRCm39) G883C probably damaging Het
Lpin1 C A 12: 16,597,500 (GRCm39) G682W probably damaging Het
Macf1 A C 4: 123,367,465 (GRCm39) L2432R probably damaging Het
Med12l T G 3: 59,205,259 (GRCm39) I2075M probably benign Het
Mroh6 A G 15: 75,756,177 (GRCm39) S660P probably benign Het
Myh6 G T 14: 55,198,699 (GRCm39) Y309* probably null Het
Myof C T 19: 37,892,291 (GRCm39) R1154H probably benign Het
Ndst3 T C 3: 123,346,186 (GRCm39) D281G possibly damaging Het
Nipbl T C 15: 8,353,182 (GRCm39) K1788R probably damaging Het
Nol12 A G 15: 78,824,717 (GRCm39) probably benign Het
Nptn A G 9: 58,550,956 (GRCm39) T212A possibly damaging Het
Nptx2 C T 5: 144,493,155 (GRCm39) A414V probably damaging Het
Nub1 A G 5: 24,913,700 (GRCm39) D503G possibly damaging Het
Obscn T A 11: 58,898,366 (GRCm39) probably benign Het
Or4a80 A G 2: 89,582,578 (GRCm39) I198T probably benign Het
Or51q1 A G 7: 103,628,545 (GRCm39) T49A probably benign Het
Or5b97 C T 19: 12,879,005 (GRCm39) M46I probably benign Het
Pcnx2 T C 8: 126,617,859 (GRCm39) E132G probably damaging Het
Pkdcc A G 17: 83,529,667 (GRCm39) probably benign Het
Prdm2 T A 4: 142,861,776 (GRCm39) I505F probably damaging Het
Psmc3 C G 2: 90,886,346 (GRCm39) Q169E probably damaging Het
Ptger4 A T 15: 5,264,654 (GRCm39) I334N probably benign Het
Ptrh1 T C 2: 32,667,183 (GRCm39) M161T probably benign Het
Rapgef6 T A 11: 54,533,582 (GRCm39) V482D possibly damaging Het
Rdh16f2 T C 10: 127,710,946 (GRCm39) S188P probably damaging Het
Rrh T C 3: 129,616,040 (GRCm39) Y31C probably damaging Het
Selp G T 1: 163,971,523 (GRCm39) W659L probably benign Het
Selp G T 1: 163,971,524 (GRCm39) W659C probably damaging Het
Shh A G 5: 28,671,740 (GRCm39) C8R probably benign Het
Spdye4b C A 5: 143,187,848 (GRCm39) S167R possibly damaging Het
Strip1 T C 3: 107,535,537 (GRCm39) Y62C possibly damaging Het
Sucla2 A T 14: 73,819,149 (GRCm39) I232F probably benign Het
Sugp1 A G 8: 70,522,174 (GRCm39) D437G possibly damaging Het
Taf1a A G 1: 183,177,422 (GRCm39) probably benign Het
Tbc1d20 T A 2: 152,153,283 (GRCm39) M271K probably damaging Het
Tecpr2 T C 12: 110,899,752 (GRCm39) S707P probably benign Het
Tert G A 13: 73,796,104 (GRCm39) R1017H probably benign Het
Tox C G 4: 6,688,886 (GRCm39) V493L probably damaging Het
Tpo C T 12: 30,153,968 (GRCm39) A246T probably benign Het
Traf7 A T 17: 24,730,613 (GRCm39) V358D probably damaging Het
Trim56 C T 5: 137,141,528 (GRCm39) V663M possibly damaging Het
Unc80 C T 1: 66,560,740 (GRCm39) H823Y possibly damaging Het
Usf3 C T 16: 44,041,045 (GRCm39) H1842Y probably damaging Het
Uvrag T C 7: 98,537,668 (GRCm39) E509G probably benign Het
Vmn2r5 T C 3: 64,411,392 (GRCm39) D305G possibly damaging Het
Vmn2r52 T C 7: 9,903,058 (GRCm39) R457G probably damaging Het
Vti1a A C 19: 55,369,411 (GRCm39) N101T possibly damaging Het
Zfp236 A G 18: 82,686,762 (GRCm39) F259L probably benign Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTCTATGAGGGAGGCTGATTC -3'
(R):5'- CCTTTCTGTGGGAGAATGGCTC -3'

Sequencing Primer
(F):5'- TGATTCCCAGAGCCAGTCC -3'
(R):5'- TCTGAGCCACAGGTGTGCAG -3'
Posted On 2014-12-04