Mutagenetix > Incidental Mutation

Incidental Mutation 'R2680:Copa'

250850

Institutional Source

Beutler Lab

Gene Symbol

Copa

Ensembl Gene

ENSMUSG00000026553

Gene Name

coatomer protein complex subunit alpha

Synonyms

xenin

MMRRC Submission

040433-MU

Accession Numbers

Genbank: NM_009938; MGI: 1334462

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R2680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172082529-172122330 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 172121404 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1199 (Q1199*)

Ref Sequence

ENSEMBL: ENSMUSP00000118179 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027833] [ENSMUST00000135192]

AlphaFold

Q8CIE6

Predicted Effect

probably null
Transcript: ENSMUST00000027833
AA Change: Q1208*

SMART Domains

Protein: ENSMUSP00000027833
Gene: ENSMUSG00000026553
AA Change: Q1208*

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	776	5.4e-144	PFAM
Pfam:COPI_C	824	1233	1.4e-190	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122845

Predicted Effect

probably null
Transcript: ENSMUST00000135192
AA Change: Q1199*

SMART Domains

Protein: ENSMUSP00000118179
Gene: ENSMUSG00000026553
AA Change: Q1199*

Domain	Start	End	E-Value	Type
WD40	2	37	2.86e0	SMART
WD40	40	79	1.11e-6	SMART
WD40	82	121	4.76e-6	SMART
WD40	124	163	2.24e-11	SMART
WD40	194	233	2.98e-7	SMART
WD40	238	277	8.42e-7	SMART
WD40	280	318	1.38e1	SMART
Pfam:Coatomer_WDAD	338	767	1.1e-148	PFAM
Pfam:COPI_C	815	1224	3.6e-216	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142765

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In eukaryotic cells, protein transport between the endoplasmic reticulum and Golgi compartments is mediated in part by non-clathrin-coated vesicular coat proteins (COPs). Seven coat proteins have been identified, and they represent subunits of a complex known as coatomer. The subunits are designated alpha-COP, beta-COP, beta-prime-COP, gamma-COP, delta-COP, epsilon-COP, and zeta-COP. The alpha-COP, encoded by COPA, shares high sequence similarity with RET1P, the alpha subunit of the coatomer complex in yeast. Also, the N-terminal 25 amino acids of alpha-COP encode the bioactive peptide, xenin, which stimulates exocrine pancreatic secretion and may act as a gastrointestinal hormone. Alternative splicing results in multiple splice forms encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	T	C	7: 139,978,561	D41G	probably damaging	Het
BC024139	A	G	15: 76,121,739	W421R	probably damaging	Het
Car11	T	C	7: 45,702,485	S113P	probably benign	Het
Ccdc146	C	T	5: 21,305,269	A582T	possibly damaging	Het
Cct8l1	A	G	5: 25,517,135	T283A	probably benign	Het
Ckap5	A	G	2: 91,588,698	I1118V	probably benign	Het
Cpd	A	T	11: 76,790,999	N1140K	probably benign	Het
Cspp1	A	G	1: 10,104,305	D661G	probably damaging	Het
Dab2	A	G	15: 6,436,993	Q729R	possibly damaging	Het
Dnah9	T	C	11: 66,033,925	I2168V	probably benign	Het
Dync1h1	G	A	12: 110,643,247	R2821H	probably damaging	Het
Ercc5	T	C	1: 44,156,973	V42A	probably benign	Het
Evc	A	G	5: 37,310,237	V566A	probably benign	Het
Fcrls	T	C	3: 87,257,349	Y290C	probably damaging	Het
Frmd4a	A	G	2: 4,534,553	R171G	probably damaging	Het
Galnt17	G	A	5: 131,111,823	P152L	probably damaging	Het
Gfi1	A	G	5: 107,721,431	L245P	probably damaging	Het
Heatr4	T	C	12: 83,980,463	K7E	possibly damaging	Het
Ifit3b	A	G	19: 34,612,305	N294D	probably benign	Het
Ift74	A	G	4: 94,653,028	Y230C	probably damaging	Het
Igsf10	C	T	3: 59,325,454	V1953I	probably benign	Het
Ikzf5	T	C	7: 131,396,761	D14G	probably damaging	Het
Il12rb2	T	A	6: 67,354,805	T259S	possibly damaging	Het
Itgae	T	A	11: 73,114,926	D305E	probably damaging	Het
Kif23	A	C	9: 61,937,476	D90E	probably benign	Het
Kprp	A	G	3: 92,824,463	F427L	unknown	Het
Lmnb1	T	A	18: 56,731,105	Y261N	probably damaging	Het
Megf8	T	C	7: 25,317,556	V17A	probably benign	Het
Mfap4	T	C	11: 61,487,231	Y190H	probably benign	Het
Mlh1	T	C	9: 111,236,017		probably null	Het
Mocos	C	A	18: 24,676,629	Q430K	probably damaging	Het
Ndst2	A	G	14: 20,724,754	F794L	probably damaging	Het
Nedd4l	A	T	18: 65,163,130	I197F	possibly damaging	Het
Nefm	A	G	14: 68,123,786	L343P	probably damaging	Het
Nfatc4	A	G	14: 55,832,834		probably benign	Het
Nlrp4a	T	A	7: 26,449,230		probably null	Het
Nlrp4f	A	T	13: 65,194,343	L496*	probably null	Het
Nom1	T	C	5: 29,443,417	F654S	probably damaging	Het
Olfr730	A	T	14: 50,186,847	Y123*	probably null	Het
Pcdhac2	A	G	18: 37,145,586	K540E	possibly damaging	Het
Pde4dip	T	C	3: 97,701,617	N1974S	possibly damaging	Het
Pik3c3	T	C	18: 30,344,078		probably null	Het
Pik3ca	T	C	3: 32,443,885	I492T	probably benign	Het
Pik3ca	C	T	3: 32,436,548	R115*	probably null	Het
Ppp1ca	G	A	19: 4,194,595	E218K	possibly damaging	Het
Prex1	G	T	2: 166,601,772	D492E	possibly damaging	Het
Scaf8	T	C	17: 3,197,591	V1063A	possibly damaging	Het
Scn3a	G	T	2: 65,536,536	N47K	probably benign	Het
Sec61a2	G	T	2: 5,873,745	N348K	probably benign	Het
Sh3rf2	A	G	18: 42,101,650	E166G	probably damaging	Het
Slc19a2	C	A	1: 164,249,413	T54K	probably damaging	Het
Slc8a3	T	A	12: 81,202,339	I765F	probably damaging	Het
Snap91	A	T	9: 86,879,550	M1K	probably null	Het
Strc	T	C	2: 121,365,111	H1619R	probably damaging	Het
Tbl1xr1	C	T	3: 22,191,451	T207M	possibly damaging	Het
Tchp	T	C	5: 114,709,519		probably null	Het
Tln1	A	T	4: 43,539,668	F1581Y	probably damaging	Het
Tnxb	T	C	17: 34,703,620	V2469A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r225	T	A	17: 20,502,793	F165L	probably benign	Het
Vmn2r13	T	C	5: 109,174,312	D173G	possibly damaging	Het
Vmn2r6	A	C	3: 64,538,286	S673A	possibly damaging	Het
Vta1	G	A	10: 14,705,427		probably benign	Het
Wwc1	T	C	11: 35,875,929	T500A	probably benign	Het
Zfp784	T	A	7: 5,036,117	Q147H	possibly damaging	Het

Other mutations in Copa

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Copa	APN	1	172110688	missense	possibly damaging	0.87
IGL01360:Copa	APN	1	172087588	splice site	probably null
IGL01434:Copa	APN	1	172119561	missense	probably benign	0.00
IGL01744:Copa	APN	1	172113189	missense	probably benign	0.01
IGL01837:Copa	APN	1	172118852	missense	probably benign	0.01
IGL01988:Copa	APN	1	172118264	missense	probably benign	0.09
IGL02059:Copa	APN	1	172099753	missense	probably damaging	0.96
IGL02123:Copa	APN	1	172112128	missense	probably damaging	1.00
IGL02731:Copa	APN	1	172102218	missense	possibly damaging	0.77
IGL03114:Copa	APN	1	172119268	nonsense	probably null
P0027:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
PIT4434001:Copa	UTSW	1	172106175	missense	probably benign	0.00
R0233:Copa	UTSW	1	172087667	critical splice donor site	probably null
R0465:Copa	UTSW	1	172118305	missense	probably damaging	1.00
R0547:Copa	UTSW	1	172121687	splice site	probably benign
R0568:Copa	UTSW	1	172112137	missense	possibly damaging	0.91
R0628:Copa	UTSW	1	172091025	splice site	probably benign
R1328:Copa	UTSW	1	172121691	splice site	probably benign
R1494:Copa	UTSW	1	172104127	missense	probably benign	0.27
R1728:Copa	UTSW	1	172111987	missense	probably benign
R1758:Copa	UTSW	1	172104144	missense	probably damaging	1.00
R1784:Copa	UTSW	1	172111987	missense	probably benign
R1942:Copa	UTSW	1	172111888	missense	probably damaging	1.00
R2054:Copa	UTSW	1	172118957	nonsense	probably null
R2299:Copa	UTSW	1	172121725	missense	probably benign	0.10
R2518:Copa	UTSW	1	172119901	missense	probably benign
R3080:Copa	UTSW	1	172113149	missense	probably damaging	1.00
R3160:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3161:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3162:Copa	UTSW	1	172091233	missense	probably damaging	1.00
R3973:Copa	UTSW	1	172121245	missense	probably benign	0.00
R3975:Copa	UTSW	1	172121245	missense	probably benign	0.00
R4031:Copa	UTSW	1	172108375	missense	probably damaging	1.00
R4155:Copa	UTSW	1	172101425	missense	probably damaging	1.00
R4227:Copa	UTSW	1	172118115	intron	probably benign
R4244:Copa	UTSW	1	172110718	missense	probably benign	0.00
R4254:Copa	UTSW	1	172102244	missense	probably damaging	1.00
R4291:Copa	UTSW	1	172092397	intron	probably benign
R4323:Copa	UTSW	1	172119264	missense	probably damaging	1.00
R4402:Copa	UTSW	1	172102224	missense	probably damaging	1.00
R4711:Copa	UTSW	1	172119988	missense	probably damaging	1.00
R4721:Copa	UTSW	1	172104274	splice site	probably benign
R4773:Copa	UTSW	1	172105220	missense	probably damaging	1.00
R4794:Copa	UTSW	1	172119321	missense	probably damaging	1.00
R4887:Copa	UTSW	1	172092276	missense	probably benign	0.39
R4953:Copa	UTSW	1	172082886	unclassified	probably benign
R5139:Copa	UTSW	1	172121329	missense	probably damaging	0.99
R5152:Copa	UTSW	1	172118061	missense	probably benign	0.34
R5297:Copa	UTSW	1	172113108	missense	probably damaging	1.00
R5586:Copa	UTSW	1	172105222	missense	probably damaging	1.00
R5698:Copa	UTSW	1	172118944	nonsense	probably null
R6283:Copa	UTSW	1	172118848	missense	possibly damaging	0.79
R6921:Copa	UTSW	1	172111924	missense	possibly damaging	0.63
R6934:Copa	UTSW	1	172110686	missense	possibly damaging	0.64
R7009:Copa	UTSW	1	172091000	missense	probably damaging	0.96
R7194:Copa	UTSW	1	172119944	missense	probably damaging	0.99
R7348:Copa	UTSW	1	172102223	missense	possibly damaging	0.96
R7710:Copa	UTSW	1	172109844	missense	possibly damaging	0.50
R7745:Copa	UTSW	1	172111942	missense	probably damaging	1.00
R7893:Copa	UTSW	1	172119565	nonsense	probably null
R8168:Copa	UTSW	1	172099672	missense	probably damaging	1.00
R8273:Copa	UTSW	1	172118979	critical splice donor site	probably null
R8704:Copa	UTSW	1	172104126	missense	probably benign	0.01
R8754:Copa	UTSW	1	172108359	missense	probably damaging	1.00
R8757:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8759:Copa	UTSW	1	172119514	missense	probably benign	0.04
R8885:Copa	UTSW	1	172097745	missense	probably damaging	1.00
R8891:Copa	UTSW	1	172119251	missense	probably damaging	1.00
R8927:Copa	UTSW	1	172104170	missense	probably null	0.03
R8928:Copa	UTSW	1	172104170	missense	probably null	0.03
R8956:Copa	UTSW	1	172109913	missense	possibly damaging	0.65
R9063:Copa	UTSW	1	172116962	missense	probably benign	0.00
R9295:Copa	UTSW	1	172112256	missense	probably damaging	0.99
R9364:Copa	UTSW	1	172117264	missense	probably benign	0.00
R9437:Copa	UTSW	1	172104145	missense	possibly damaging	0.93
R9673:Copa	UTSW	1	172118081	missense	probably benign	0.11
T0722:Copa	UTSW	1	172111948	missense	possibly damaging	0.87
Z1177:Copa	UTSW	1	172106123	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TACTTGCGTTGTCATGTCCTG -3'
(R):5'- CCCAGTGTCCCTGCCTCAG -3'

Sequencing Primer
(F):5'- CAGGCTGTCCTAGAACTTGAGATC -3'
(R):5'- TCAGGGAGCGGGGCAAATG -3'

Posted On

2014-12-04