Incidental Mutation 'R2680:Frmd4a'
ID250852
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4534553 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 171 (R171G)
Ref Sequence ENSEMBL: ENSMUSP00000075172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000115037] [ENSMUST00000175669] [ENSMUST00000175944] [ENSMUST00000176803] [ENSMUST00000177457]
Predicted Effect probably damaging
Transcript: ENSMUST00000075767
AA Change: R171G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: R171G

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000091497
AA Change: R182G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: R182G

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115037
SMART Domains Protein: ENSMUSP00000110689
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
B41 1 142 9.86e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147156
Predicted Effect possibly damaging
Transcript: ENSMUST00000175669
AA Change: R201G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135306
Gene: ENSMUSG00000026657
AA Change: R201G

DomainStartEndE-ValueType
B41 31 236 3.24e-40 SMART
FERM_C 240 341 7.69e-27 SMART
low complexity region 371 387 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000175944
AA Change: R219G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657
AA Change: R219G

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176803
SMART Domains Protein: ENSMUSP00000135432
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
Pfam:FERM_N 10 89 5.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177457
AA Change: R186G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: R186G

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4384:Frmd4a UTSW 2 4594563 nonsense probably null
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7583:Frmd4a UTSW 2 4594597 frame shift probably null
R7697:Frmd4a UTSW 2 4484081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCACGTGAGCAACATTGAG -3'
(R):5'- CATCTGCATAGACAAGTGCAC -3'

Sequencing Primer
(F):5'- CACGTGAGCAACATTGAGAAATATC -3'
(R):5'- ATAATGCACATTGCCATGCCTGG -3'
Posted On2014-12-04