Incidental Mutation 'R2680:Sec61a2'
ID250854
Institutional Source Beutler Lab
Gene Symbol Sec61a2
Ensembl Gene ENSMUSG00000025816
Gene NameSec61, alpha subunit 2 (S. cerevisiae)
Synonyms
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location5870987-5895432 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5873745 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 348 (N348K)
Ref Sequence ENSEMBL: ENSMUSP00000141333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026926] [ENSMUST00000026927] [ENSMUST00000102981] [ENSMUST00000193792]
Predicted Effect probably benign
Transcript: ENSMUST00000026926
SMART Domains Protein: ENSMUSP00000026926
Gene: ENSMUSG00000025816

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.9e-24 PFAM
Pfam:SecY 75 162 1.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026927
SMART Domains Protein: ENSMUSP00000026927
Gene: ENSMUSG00000025817

DomainStartEndE-ValueType
Pfam:NUDIX 57 191 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102981
AA Change: N414K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100046
Gene: ENSMUSG00000025816
AA Change: N414K

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 6.2e-21 PFAM
Pfam:SecY 75 458 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132469
Predicted Effect unknown
Transcript: ENSMUST00000132908
AA Change: N57K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153240
Predicted Effect probably benign
Transcript: ENSMUST00000193792
AA Change: N348K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141333
Gene: ENSMUSG00000025816
AA Change: N348K

DomainStartEndE-ValueType
Pfam:Plug_translocon 40 74 4e-22 PFAM
Pfam:SecY 75 263 5.3e-44 PFAM
Pfam:SecY 261 393 1.6e-34 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to a mouse protein which suggests a role in the insertion of secretory and membrane polypeptides into the endoplasmic reticulum. It may also be required for the assembly of membrane and secretory proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Sec61a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Sec61a2 APN 2 5872020 missense possibly damaging 0.93
IGL01690:Sec61a2 APN 2 5886552 missense possibly damaging 0.57
IGL01999:Sec61a2 APN 2 5891363 splice site probably benign
IGL02608:Sec61a2 APN 2 5874262 missense probably benign 0.01
IGL03131:Sec61a2 APN 2 5882878 nonsense probably null
IGL03271:Sec61a2 APN 2 5882934 nonsense probably null
IGL03294:Sec61a2 APN 2 5876465 unclassified probably null
R0413:Sec61a2 UTSW 2 5876354 intron probably benign
R0742:Sec61a2 UTSW 2 5876548 missense probably benign 0.01
R1659:Sec61a2 UTSW 2 5886534 missense possibly damaging 0.91
R1929:Sec61a2 UTSW 2 5873736 splice site probably benign
R3522:Sec61a2 UTSW 2 5893216 missense probably benign 0.00
R3788:Sec61a2 UTSW 2 5879625 utr 3 prime probably null
R4405:Sec61a2 UTSW 2 5882859 missense probably benign 0.40
R4660:Sec61a2 UTSW 2 5873693 intron probably benign
R5387:Sec61a2 UTSW 2 5882545 intron probably benign
R5530:Sec61a2 UTSW 2 5882650 nonsense probably null
R5546:Sec61a2 UTSW 2 5876540 missense possibly damaging 0.78
R5775:Sec61a2 UTSW 2 5882774 intron probably null
R5922:Sec61a2 UTSW 2 5874323 missense possibly damaging 0.82
R5937:Sec61a2 UTSW 2 5886557 missense probably benign 0.00
R6681:Sec61a2 UTSW 2 5876408 nonsense probably null
R7499:Sec61a2 UTSW 2 5877914 missense probably benign 0.37
R7564:Sec61a2 UTSW 2 5882604 missense probably benign
Z1177:Sec61a2 UTSW 2 5886565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCAAAGTGTATGTGCGAGG -3'
(R):5'- TGCCAGCATTGTAGGGCTTAG -3'

Sequencing Primer
(F):5'- AGGAGGTGACAGGAATGATGTTTTC -3'
(R):5'- GTGGCCAAGCAACTTAAA -3'
Posted On2014-12-04