Mutagenetix > Incidental Mutations

Incidental Mutation 'R2680:Tbl1xr1'

250864

Institutional Source

Beutler Lab

Gene Symbol

Tbl1xr1

Ensembl Gene

ENSMUSG00000027630

Gene Name

transducin (beta)-like 1X-linked receptor 1

Synonyms

8030499H02Rik, Ira1, DC42, A630076E03Rik, C21, C230089I12Rik, TBLR1

MMRRC Submission

040433-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.883) question?

Stock #

R2680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22076652-22216594 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 22191451 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 207 (T207M)

Ref Sequence

ENSEMBL: ENSMUSP00000144436 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063988] [ENSMUST00000192328] [ENSMUST00000193734] [ENSMUST00000200793] [ENSMUST00000200943] [ENSMUST00000201509] [ENSMUST00000202356] [ENSMUST00000202747]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063988
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000067164
Gene: ENSMUSG00000027630
AA Change: T207M

Domain	Start	End	E-Value	Type
LisH	4	36	5.63e-6	SMART
low complexity region	124	138	N/A	INTRINSIC
WD40	158	197	4.91e-8	SMART
WD40	208	253	9.38e-5	SMART
WD40	255	294	4.51e-7	SMART
WD40	297	335	6.89e-3	SMART
WD40	338	377	9.22e-13	SMART
WD40	380	428	1.64e-9	SMART
WD40	431	470	3.26e-13	SMART
WD40	473	511	3.85e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000192328
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000141363
Gene: ENSMUSG00000027630
AA Change: T207M

Domain	Start	End	E-Value	Type
LisH	4	36	5.63e-6	SMART
low complexity region	124	138	N/A	INTRINSIC
WD40	158	197	4.91e-8	SMART
WD40	208	253	9.38e-5	SMART
WD40	255	294	4.51e-7	SMART
WD40	297	335	6.89e-3	SMART
WD40	338	377	9.22e-13	SMART
WD40	380	428	1.64e-9	SMART
WD40	431	470	3.26e-13	SMART
WD40	473	511	3.85e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193734
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142184
Gene: ENSMUSG00000027630
AA Change: T207M

Domain	Start	End	E-Value	Type
LisH	4	36	5.63e-6	SMART
low complexity region	124	138	N/A	INTRINSIC
WD40	158	197	4.91e-8	SMART
WD40	208	253	9.38e-5	SMART
WD40	255	294	4.51e-7	SMART
WD40	297	335	6.89e-3	SMART
WD40	338	377	9.22e-13	SMART
WD40	380	428	1.64e-9	SMART
WD40	431	470	3.26e-13	SMART
WD40	473	511	3.85e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000200793

SMART Domains

Protein: ENSMUSP00000144138
Gene: ENSMUSG00000027630

Domain	Start	End	E-Value	Type
LisH	4	36	1.7e-8	SMART
low complexity region	124	138	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000200943

SMART Domains

Protein: ENSMUSP00000144602
Gene: ENSMUSG00000027630

Domain	Start	End	E-Value	Type
LisH	4	36	1.7e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201509
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000144547
Gene: ENSMUSG00000027630
AA Change: T207M

Domain	Start	End	E-Value	Type
LisH	4	36	1.7e-8	SMART
low complexity region	124	138	N/A	INTRINSIC
WD40	158	197	3.2e-10	SMART
WD40	208	253	6.2e-7	SMART
WD40	255	294	2.9e-9	SMART
WD40	297	335	4.5e-5	SMART
WD40	338	377	5.9e-15	SMART
WD40	380	428	1.1e-11	SMART
WD40	431	470	2.1e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202149

Predicted Effect

probably benign
Transcript: ENSMUST00000202356

SMART Domains

Protein: ENSMUSP00000144301
Gene: ENSMUSG00000027630

Domain	Start	End	E-Value	Type
LisH	4	36	1.7e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202647

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202747
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000144436
Gene: ENSMUSG00000027630
AA Change: T207M

Domain	Start	End	E-Value	Type
LisH	4	36	5.63e-6	SMART
low complexity region	124	138	N/A	INTRINSIC
WD40	158	197	4.91e-8	SMART
WD40	208	253	9.38e-5	SMART
WD40	255	294	4.51e-7	SMART
WD40	297	335	6.89e-3	SMART
WD40	338	377	9.22e-13	SMART
WD40	380	428	1.64e-9	SMART
WD40	431	470	3.26e-13	SMART
WD40	473	511	3.85e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WD40 repeat-containing gene family and shares sequence similarity with transducin (beta)-like 1X-linked (TBL1X). The protein encoded by this gene is thought to be a component of both nuclear receptor corepressor (N-CoR) and histone deacetylase 3 (HDAC 3) complexes, and is required for transcriptional activation by a variety of transcription factors. Mutations in these gene have been associated with some autism spectrum disorders, and one finding suggests that haploinsufficiency of this gene may be a cause of intellectual disability with dysmorphism. Mutations in this gene as well as recurrent translocations involving this gene have also been observed in some tumors. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in adipose tissue exhibit increased body weight, and total body fat and increased susceptibility to diet-induced obesity and impaired glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	T	C	7: 139,978,561	D41G	probably damaging	Het
BC024139	A	G	15: 76,121,739	W421R	probably damaging	Het
Car11	T	C	7: 45,702,485	S113P	probably benign	Het
Ccdc146	C	T	5: 21,305,269	A582T	possibly damaging	Het
Cct8l1	A	G	5: 25,517,135	T283A	probably benign	Het
Ckap5	A	G	2: 91,588,698	I1118V	probably benign	Het
Copa	C	T	1: 172,121,404	Q1199*	probably null	Het
Cpd	A	T	11: 76,790,999	N1140K	probably benign	Het
Cspp1	A	G	1: 10,104,305	D661G	probably damaging	Het
Dab2	A	G	15: 6,436,993	Q729R	possibly damaging	Het
Dnah9	T	C	11: 66,033,925	I2168V	probably benign	Het
Dync1h1	G	A	12: 110,643,247	R2821H	probably damaging	Het
Ercc5	T	C	1: 44,156,973	V42A	probably benign	Het
Evc	A	G	5: 37,310,237	V566A	probably benign	Het
Fcrls	T	C	3: 87,257,349	Y290C	probably damaging	Het
Frmd4a	A	G	2: 4,534,553	R171G	probably damaging	Het
Galnt17	G	A	5: 131,111,823	P152L	probably damaging	Het
Gfi1	A	G	5: 107,721,431	L245P	probably damaging	Het
Heatr4	T	C	12: 83,980,463	K7E	possibly damaging	Het
Ifit3b	A	G	19: 34,612,305	N294D	probably benign	Het
Ift74	A	G	4: 94,653,028	Y230C	probably damaging	Het
Igsf10	C	T	3: 59,325,454	V1953I	probably benign	Het
Ikzf5	T	C	7: 131,396,761	D14G	probably damaging	Het
Il12rb2	T	A	6: 67,354,805	T259S	possibly damaging	Het
Itgae	T	A	11: 73,114,926	D305E	probably damaging	Het
Kif23	A	C	9: 61,937,476	D90E	probably benign	Het
Kprp	A	G	3: 92,824,463	F427L	unknown	Het
Lmnb1	T	A	18: 56,731,105	Y261N	probably damaging	Het
Megf8	T	C	7: 25,317,556	V17A	probably benign	Het
Mfap4	T	C	11: 61,487,231	Y190H	probably benign	Het
Mlh1	T	C	9: 111,236,017		probably null	Het
Mocos	C	A	18: 24,676,629	Q430K	probably damaging	Het
Ndst2	A	G	14: 20,724,754	F794L	probably damaging	Het
Nedd4l	A	T	18: 65,163,130	I197F	possibly damaging	Het
Nefm	A	G	14: 68,123,786	L343P	probably damaging	Het
Nfatc4	A	G	14: 55,832,834		probably benign	Het
Nlrp4a	T	A	7: 26,449,230		probably null	Het
Nlrp4f	A	T	13: 65,194,343	L496*	probably null	Het
Nom1	T	C	5: 29,443,417	F654S	probably damaging	Het
Olfr730	A	T	14: 50,186,847	Y123*	probably null	Het
Pcdhac2	A	G	18: 37,145,586	K540E	possibly damaging	Het
Pde4dip	T	C	3: 97,701,617	N1974S	possibly damaging	Het
Pik3c3	T	C	18: 30,344,078		probably null	Het
Pik3ca	C	T	3: 32,436,548	R115*	probably null	Het
Pik3ca	T	C	3: 32,443,885	I492T	probably benign	Het
Ppp1ca	G	A	19: 4,194,595	E218K	possibly damaging	Het
Prex1	G	T	2: 166,601,772	D492E	possibly damaging	Het
Scaf8	T	C	17: 3,197,591	V1063A	possibly damaging	Het
Scn3a	G	T	2: 65,536,536	N47K	probably benign	Het
Sec61a2	G	T	2: 5,873,745	N348K	probably benign	Het
Sh3rf2	A	G	18: 42,101,650	E166G	probably damaging	Het
Slc19a2	C	A	1: 164,249,413	T54K	probably damaging	Het
Slc8a3	T	A	12: 81,202,339	I765F	probably damaging	Het
Snap91	A	T	9: 86,879,550	M1K	probably null	Het
Strc	T	C	2: 121,365,111	H1619R	probably damaging	Het
Tchp	T	C	5: 114,709,519		probably null	Het
Tln1	A	T	4: 43,539,668	F1581Y	probably damaging	Het
Tnxb	T	C	17: 34,703,620	V2469A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r225	T	A	17: 20,502,793	F165L	probably benign	Het
Vmn2r13	T	C	5: 109,174,312	D173G	possibly damaging	Het
Vmn2r6	A	C	3: 64,538,286	S673A	possibly damaging	Het
Vta1	G	A	10: 14,705,427		probably benign	Het
Wwc1	T	C	11: 35,875,929	T500A	probably benign	Het
Zfp784	T	A	7: 5,036,117	Q147H	possibly damaging	Het

Other mutations in Tbl1xr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Tbl1xr1	APN	3	22192268	critical splice donor site	probably null
IGL00825:Tbl1xr1	APN	3	22189786	splice site	probably null
IGL01622:Tbl1xr1	APN	3	22192074	missense	probably benign	0.01
IGL01623:Tbl1xr1	APN	3	22192074	missense	probably benign	0.01
IGL01717:Tbl1xr1	APN	3	22193171	splice site	probably benign
IGL02421:Tbl1xr1	APN	3	22203163	missense	probably damaging	0.99
IGL03117:Tbl1xr1	APN	3	22203159	nonsense	probably null
R0076:Tbl1xr1	UTSW	3	22189785	missense	probably benign	0.06
R0601:Tbl1xr1	UTSW	3	22179319	splice site	probably benign
R0629:Tbl1xr1	UTSW	3	22210401	missense	probably benign	0.41
R0654:Tbl1xr1	UTSW	3	22203994	critical splice donor site	probably null
R0811:Tbl1xr1	UTSW	3	22200587	splice site	probably benign
R1457:Tbl1xr1	UTSW	3	22193169	critical splice donor site	probably null
R1496:Tbl1xr1	UTSW	3	22190951	missense	possibly damaging	0.68
R1914:Tbl1xr1	UTSW	3	22190910	splice site	probably benign
R3929:Tbl1xr1	UTSW	3	22189768	missense	probably damaging	1.00
R4193:Tbl1xr1	UTSW	3	22200358	missense	possibly damaging	0.90
R4440:Tbl1xr1	UTSW	3	22200588	critical splice acceptor site	probably null
R4642:Tbl1xr1	UTSW	3	22188420	missense	probably damaging	1.00
R5187:Tbl1xr1	UTSW	3	22209606	missense	probably damaging	1.00
R5361:Tbl1xr1	UTSW	3	22192069	missense	probably damaging	0.97
R5430:Tbl1xr1	UTSW	3	22192082	missense	probably benign	0.01
R5710:Tbl1xr1	UTSW	3	22210414	missense	probably damaging	0.99
R6490:Tbl1xr1	UTSW	3	22203977	missense	probably damaging	0.97
R6512:Tbl1xr1	UTSW	3	22140534	intron	probably benign
R6778:Tbl1xr1	UTSW	3	22189782	missense	probably benign	0.00
R6861:Tbl1xr1	UTSW	3	22191439	missense	possibly damaging	0.68
R6861:Tbl1xr1	UTSW	3	22191539	splice site	probably null
R6878:Tbl1xr1	UTSW	3	22203204	missense	possibly damaging	0.90
R6998:Tbl1xr1	UTSW	3	22179290	missense	probably damaging	1.00
R7409:Tbl1xr1	UTSW	3	22203190	missense	possibly damaging	0.56
R8029:Tbl1xr1	UTSW	3	22200436	missense	probably damaging	0.98
R8670:Tbl1xr1	UTSW	3	22191000	missense	probably damaging	1.00
X0011:Tbl1xr1	UTSW	3	22203092	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGCTACATAGATTTCACTTTCCG -3'
(R):5'- ATATGGGGCCAGATTGAAGC -3'

Sequencing Primer
(F):5'- ACTTTCCGGTCATTTTACCTTAGTAG -3'
(R):5'- CCAGATTGAAGCTAAAATTGGGATC -3'

Posted On

2014-12-04