Incidental Mutation 'R2680:Tbl1xr1'
List |< first << previous [record 56 of 66] next >> last >|
ID250864
Institutional Source Beutler Lab
Gene Symbol Tbl1xr1
Ensembl Gene ENSMUSG00000027630
Gene Nametransducin (beta)-like 1X-linked receptor 1
Synonyms8030499H02Rik, Ira1, DC42, A630076E03Rik, C21, C230089I12Rik, TBLR1
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location22076652-22216594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22191451 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 207 (T207M)
Ref Sequence ENSEMBL: ENSMUSP00000144436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063988] [ENSMUST00000192328] [ENSMUST00000193734] [ENSMUST00000200793] [ENSMUST00000200943] [ENSMUST00000201509] [ENSMUST00000202356] [ENSMUST00000202747]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063988
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000067164
Gene: ENSMUSG00000027630
AA Change: T207M

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192328
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141363
Gene: ENSMUSG00000027630
AA Change: T207M

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193734
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142184
Gene: ENSMUSG00000027630
AA Change: T207M

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200793
SMART Domains Protein: ENSMUSP00000144138
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200943
SMART Domains Protein: ENSMUSP00000144602
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000201509
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144547
Gene: ENSMUSG00000027630
AA Change: T207M

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 3.2e-10 SMART
WD40 208 253 6.2e-7 SMART
WD40 255 294 2.9e-9 SMART
WD40 297 335 4.5e-5 SMART
WD40 338 377 5.9e-15 SMART
WD40 380 428 1.1e-11 SMART
WD40 431 470 2.1e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202149
Predicted Effect probably benign
Transcript: ENSMUST00000202356
SMART Domains Protein: ENSMUSP00000144301
Gene: ENSMUSG00000027630

DomainStartEndE-ValueType
LisH 4 36 1.7e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202647
Predicted Effect possibly damaging
Transcript: ENSMUST00000202747
AA Change: T207M

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000144436
Gene: ENSMUSG00000027630
AA Change: T207M

DomainStartEndE-ValueType
LisH 4 36 5.63e-6 SMART
low complexity region 124 138 N/A INTRINSIC
WD40 158 197 4.91e-8 SMART
WD40 208 253 9.38e-5 SMART
WD40 255 294 4.51e-7 SMART
WD40 297 335 6.89e-3 SMART
WD40 338 377 9.22e-13 SMART
WD40 380 428 1.64e-9 SMART
WD40 431 470 3.26e-13 SMART
WD40 473 511 3.85e-1 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the WD40 repeat-containing gene family and shares sequence similarity with transducin (beta)-like 1X-linked (TBL1X). The protein encoded by this gene is thought to be a component of both nuclear receptor corepressor (N-CoR) and histone deacetylase 3 (HDAC 3) complexes, and is required for transcriptional activation by a variety of transcription factors. Mutations in these gene have been associated with some autism spectrum disorders, and one finding suggests that haploinsufficiency of this gene may be a cause of intellectual disability with dysmorphism. Mutations in this gene as well as recurrent translocations involving this gene have also been observed in some tumors. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in adipose tissue exhibit increased body weight, and total body fat and increased susceptibility to diet-induced obesity and impaired glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Tbl1xr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Tbl1xr1 APN 3 22192268 critical splice donor site probably null
IGL00825:Tbl1xr1 APN 3 22189786 splice site probably null
IGL01622:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01623:Tbl1xr1 APN 3 22192074 missense probably benign 0.01
IGL01717:Tbl1xr1 APN 3 22193171 splice site probably benign
IGL02421:Tbl1xr1 APN 3 22203163 missense probably damaging 0.99
IGL03117:Tbl1xr1 APN 3 22203159 nonsense probably null
R0076:Tbl1xr1 UTSW 3 22189785 missense probably benign 0.06
R0601:Tbl1xr1 UTSW 3 22179319 splice site probably benign
R0629:Tbl1xr1 UTSW 3 22210401 missense probably benign 0.41
R0654:Tbl1xr1 UTSW 3 22203994 critical splice donor site probably null
R0811:Tbl1xr1 UTSW 3 22200587 splice site probably benign
R1457:Tbl1xr1 UTSW 3 22193169 critical splice donor site probably null
R1496:Tbl1xr1 UTSW 3 22190951 missense possibly damaging 0.68
R1914:Tbl1xr1 UTSW 3 22190910 splice site probably benign
R3929:Tbl1xr1 UTSW 3 22189768 missense probably damaging 1.00
R4193:Tbl1xr1 UTSW 3 22200358 missense possibly damaging 0.90
R4440:Tbl1xr1 UTSW 3 22200588 critical splice acceptor site probably null
R4642:Tbl1xr1 UTSW 3 22188420 missense probably damaging 1.00
R5187:Tbl1xr1 UTSW 3 22209606 missense probably damaging 1.00
R5361:Tbl1xr1 UTSW 3 22192069 missense probably damaging 0.97
R5430:Tbl1xr1 UTSW 3 22192082 missense probably benign 0.01
R5710:Tbl1xr1 UTSW 3 22210414 missense probably damaging 0.99
R6490:Tbl1xr1 UTSW 3 22203977 missense probably damaging 0.97
R6512:Tbl1xr1 UTSW 3 22140534 intron probably benign
R6778:Tbl1xr1 UTSW 3 22189782 missense probably benign 0.00
R6861:Tbl1xr1 UTSW 3 22191439 missense possibly damaging 0.68
R6861:Tbl1xr1 UTSW 3 22191539 splice site probably null
R6878:Tbl1xr1 UTSW 3 22203204 missense possibly damaging 0.90
R6998:Tbl1xr1 UTSW 3 22179290 missense probably damaging 1.00
R7409:Tbl1xr1 UTSW 3 22203190 missense possibly damaging 0.56
R8029:Tbl1xr1 UTSW 3 22200436 missense probably damaging 0.98
R8670:Tbl1xr1 UTSW 3 22191000 missense probably damaging 1.00
X0011:Tbl1xr1 UTSW 3 22203092 splice site probably null
Predicted Primers PCR Primer
(F):5'- ACTGCTACATAGATTTCACTTTCCG -3'
(R):5'- ATATGGGGCCAGATTGAAGC -3'

Sequencing Primer
(F):5'- ACTTTCCGGTCATTTTACCTTAGTAG -3'
(R):5'- CCAGATTGAAGCTAAAATTGGGATC -3'
Posted On2014-12-04