Incidental Mutation 'R2680:Kprp'
ID250876
Institutional Source Beutler Lab
Gene Symbol Kprp
Ensembl Gene ENSMUSG00000059832
Gene Namekeratinocyte expressed, proline-rich
Synonyms1110001M24Rik
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92823074-92827247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92824463 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 427 (F427L)
Ref Sequence ENSEMBL: ENSMUSP00000072200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072363]
Predicted Effect unknown
Transcript: ENSMUST00000072363
AA Change: F427L
SMART Domains Protein: ENSMUSP00000072200
Gene: ENSMUSG00000059832
AA Change: F427L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 292 302 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 380 397 N/A INTRINSIC
low complexity region 446 502 N/A INTRINSIC
low complexity region 515 534 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a proline-rich skin protein possibly involved in keratinocyte differentiation. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Kprp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00727:Kprp APN 3 92824427 missense unknown
IGL01566:Kprp APN 3 92823964 missense probably benign 0.11
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0062:Kprp UTSW 3 92824682 missense probably damaging 1.00
R0244:Kprp UTSW 3 92825411 missense probably benign 0.06
R0364:Kprp UTSW 3 92824335 nonsense probably null
R0414:Kprp UTSW 3 92825713 missense probably damaging 1.00
R0511:Kprp UTSW 3 92824723 missense probably damaging 1.00
R0555:Kprp UTSW 3 92824357 missense unknown
R0800:Kprp UTSW 3 92825035 missense unknown
R1356:Kprp UTSW 3 92825602 missense probably damaging 1.00
R1550:Kprp UTSW 3 92824726 missense probably damaging 0.96
R1571:Kprp UTSW 3 92825382 nonsense probably null
R1618:Kprp UTSW 3 92825476 missense probably damaging 0.99
R2424:Kprp UTSW 3 92825605 missense probably damaging 1.00
R3605:Kprp UTSW 3 92824281 missense unknown
R3606:Kprp UTSW 3 92824281 missense unknown
R3607:Kprp UTSW 3 92824281 missense unknown
R3755:Kprp UTSW 3 92825039 missense unknown
R4116:Kprp UTSW 3 92823968 missense probably damaging 1.00
R4204:Kprp UTSW 3 92824739 missense probably damaging 0.99
R4320:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4321:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4323:Kprp UTSW 3 92824856 missense probably damaging 1.00
R4575:Kprp UTSW 3 92823964 missense probably benign 0.11
R4864:Kprp UTSW 3 92824522 missense unknown
R5133:Kprp UTSW 3 92824522 missense unknown
R5583:Kprp UTSW 3 92824336 missense unknown
R5902:Kprp UTSW 3 92824528 missense unknown
R5990:Kprp UTSW 3 92824774 missense probably damaging 1.00
R6198:Kprp UTSW 3 92824687 missense probably damaging 1.00
R6633:Kprp UTSW 3 92825293 missense probably damaging 1.00
R7025:Kprp UTSW 3 92825197 missense probably benign 0.03
R7269:Kprp UTSW 3 92823871 missense probably damaging 0.96
R7951:Kprp UTSW 3 92824330 missense unknown
R8298:Kprp UTSW 3 92825300 missense probably damaging 1.00
Z1088:Kprp UTSW 3 92825057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCGCCTTAATGGAGGACATGG -3'
(R):5'- GATGTGGACCCAAATGCAGG -3'

Sequencing Primer
(F):5'- ACATGGGCGAGGTTCTGGAC -3'
(R):5'- AATGCAGGGTAGAGATTTCCTCCC -3'
Posted On2014-12-04