Incidental Mutation 'R0309:Or6c6c'
ID 25089
Institutional Source Beutler Lab
Gene Symbol Or6c6c
Ensembl Gene ENSMUSG00000095401
Gene Name olfactory receptor family 6 subfamily C member 6C
Synonyms GA_x6K02T2PULF-11383575-11384519, MOR110-7, Olfr804
MMRRC Submission 038519-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R0309 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 129540749-129541693 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 129541008 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 87 (D87G)
Ref Sequence ENSEMBL: ENSMUSP00000150132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077312] [ENSMUST00000213331]
AlphaFold Q7TRH7
Predicted Effect probably benign
Transcript: ENSMUST00000077312
AA Change: D87G

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076540
Gene: ENSMUSG00000095401
AA Change: D87G

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6e-48 PFAM
Pfam:7tm_1 39 288 3.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213331
AA Change: D87G

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216747
Meta Mutation Damage Score 0.3567 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.6%
  • 10x: 94.3%
  • 20x: 86.4%
Validation Efficiency 98% (125/127)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik T C 2: 35,266,271 (GRCm39) D133G possibly damaging Het
Abcb4 A C 5: 8,989,835 (GRCm39) D796A probably damaging Het
Actg2 A T 6: 83,496,896 (GRCm39) V147E probably damaging Het
Adamts13 A C 2: 26,877,001 (GRCm39) T534P probably damaging Het
Ago1 T C 4: 126,336,959 (GRCm39) T249A probably benign Het
Ahnak T A 19: 8,979,859 (GRCm39) I381N probably damaging Het
Akap9 A G 5: 4,119,038 (GRCm39) D3515G probably benign Het
Angptl3 T C 4: 98,922,706 (GRCm39) V249A probably benign Het
Ank A G 15: 27,567,658 (GRCm39) T294A possibly damaging Het
Ank1 A T 8: 23,594,825 (GRCm39) H204L probably damaging Het
Apbb2 A G 5: 66,468,331 (GRCm39) probably benign Het
Arhgap28 A T 17: 68,208,424 (GRCm39) S15T probably benign Het
Aspm T C 1: 139,410,249 (GRCm39) probably benign Het
Atp1a4 T C 1: 172,062,554 (GRCm39) E651G probably damaging Het
B3gnt2 A T 11: 22,786,860 (GRCm39) F109L probably damaging Het
Bpifb4 T C 2: 153,801,603 (GRCm39) F575L probably damaging Het
Calhm4 A G 10: 33,920,043 (GRCm39) W75R probably damaging Het
Calr C A 8: 85,569,660 (GRCm39) K322N probably benign Het
Ccdc188 T C 16: 18,037,169 (GRCm39) S247P possibly damaging Het
Cdr1 T A X: 60,228,908 (GRCm39) D86V unknown Het
Cep97 C T 16: 55,745,421 (GRCm39) V48I probably damaging Het
Chaf1b T A 16: 93,681,399 (GRCm39) C6S probably damaging Het
Chd3 C T 11: 69,247,844 (GRCm39) D920N probably damaging Het
Clk1 T C 1: 58,452,192 (GRCm39) probably benign Het
Cntnap3 T A 13: 64,905,250 (GRCm39) probably benign Het
Col12a1 T A 9: 79,507,293 (GRCm39) probably null Het
Col17a1 G T 19: 47,659,801 (GRCm39) probably benign Het
Coq7 T A 7: 118,128,940 (GRCm39) I32F possibly damaging Het
Cox6a2 A T 7: 127,805,107 (GRCm39) F59I probably damaging Het
Cpq A G 15: 33,594,297 (GRCm39) D436G probably damaging Het
Ctso G A 3: 81,852,168 (GRCm39) probably null Het
Cxadr A T 16: 78,131,836 (GRCm39) H274L probably benign Het
Cyp2c40 A T 19: 39,766,495 (GRCm39) C367S possibly damaging Het
Cyp2c70 T G 19: 40,149,115 (GRCm39) M344L possibly damaging Het
Defa35 G A 8: 21,555,871 (GRCm39) V77I probably benign Het
Dhx57 A G 17: 80,582,310 (GRCm39) Y432H probably damaging Het
Dhx9 A T 1: 153,341,441 (GRCm39) D601E probably benign Het
Dnah7a C G 1: 53,444,849 (GRCm39) D3952H probably damaging Het
Dnah9 C A 11: 65,917,798 (GRCm39) probably benign Het
Dstyk C A 1: 132,384,602 (GRCm39) probably benign Het
Efcab2 T A 1: 178,303,469 (GRCm39) probably benign Het
Ehbp1l1 T C 19: 5,770,598 (GRCm39) E287G possibly damaging Het
Epgn A G 5: 91,180,073 (GRCm39) T87A probably benign Het
Erc2 A C 14: 27,863,182 (GRCm39) E803A probably damaging Het
Fer A G 17: 64,446,011 (GRCm39) *454W probably null Het
Glyr1 T C 16: 4,849,836 (GRCm39) D179G probably damaging Het
Gm12830 T A 4: 114,702,173 (GRCm39) probably benign Het
Gm9922 C A 14: 101,967,129 (GRCm39) probably benign Het
Gsta3 C T 1: 21,335,118 (GRCm39) P200S possibly damaging Het
Hmgxb3 G A 18: 61,288,200 (GRCm39) probably benign Het
Hsh2d G A 8: 72,954,304 (GRCm39) D229N probably benign Het
Il16 T C 7: 83,371,762 (GRCm39) K15E probably damaging Het
Kcnip2 T A 19: 45,782,514 (GRCm39) probably benign Het
Kdm4c T C 4: 74,263,804 (GRCm39) V696A probably benign Het
Kdr A G 5: 76,107,587 (GRCm39) probably benign Het
Klhl33 T G 14: 51,128,868 (GRCm39) H787P probably damaging Het
Klk14 A T 7: 43,343,769 (GRCm39) T159S probably benign Het
Lancl2 A G 6: 57,680,117 (GRCm39) N16D probably damaging Het
Lemd3 T C 10: 120,773,015 (GRCm39) N583S possibly damaging Het
Map3k4 TGCTGGCTTCAGGGCCACAGTCCGCTG TGCTG 17: 12,489,902 (GRCm39) probably null Het
Mpl T G 4: 118,303,235 (GRCm39) probably benign Het
Myh7b T C 2: 155,472,592 (GRCm39) probably benign Het
Mylk A C 16: 34,732,667 (GRCm39) probably benign Het
Myof A T 19: 37,969,714 (GRCm39) M316K probably benign Het
Nfib T A 4: 82,214,974 (GRCm39) N543I probably damaging Het
Nfix A G 8: 85,448,403 (GRCm39) S375P probably damaging Het
Nkrf T C X: 36,153,769 (GRCm39) Q171R probably damaging Het
Nmnat2 T A 1: 152,952,747 (GRCm39) probably benign Het
Npffr2 G A 5: 89,731,206 (GRCm39) E379K probably benign Het
Npr2 T C 4: 43,640,904 (GRCm39) probably benign Het
Nup98 A C 7: 101,801,635 (GRCm39) D212E probably null Het
Nwd2 T C 5: 63,964,561 (GRCm39) Y1382H probably damaging Het
Ocstamp T C 2: 165,237,912 (GRCm39) R451G possibly damaging Het
Or52s1 T A 7: 102,861,928 (GRCm39) I287K probably damaging Het
Pabpc1 C T 15: 36,597,737 (GRCm39) A551T possibly damaging Het
Pard3 A T 8: 128,103,378 (GRCm39) probably benign Het
Pcdhb12 G T 18: 37,569,174 (GRCm39) V107L probably benign Het
Pik3cd A T 4: 149,747,677 (GRCm39) V22D probably damaging Het
Pkd1l2 A G 8: 117,724,315 (GRCm39) V2396A probably damaging Het
Pnpla7 T C 2: 24,877,207 (GRCm39) I167T probably damaging Het
Pphln1 A T 15: 93,339,588 (GRCm39) H114L possibly damaging Het
Ppm1h A G 10: 122,756,687 (GRCm39) N444S probably damaging Het
Prdm9 G A 17: 15,777,646 (GRCm39) T146I probably damaging Het
Prrc2a A G 17: 35,369,891 (GRCm39) probably benign Het
Prrx1 T C 1: 163,140,128 (GRCm39) D26G possibly damaging Het
Ptpn5 T C 7: 46,729,042 (GRCm39) E495G probably damaging Het
Rab23 A C 1: 33,773,942 (GRCm39) probably null Het
Ralgps1 C T 2: 33,047,935 (GRCm39) M348I probably benign Het
Ranbp2 A G 10: 58,315,690 (GRCm39) T2137A probably benign Het
Rapgef4 G T 2: 72,056,374 (GRCm39) G654V probably benign Het
Rc3h2 A T 2: 37,269,020 (GRCm39) probably benign Het
Reg2 G A 6: 78,383,169 (GRCm39) A39T possibly damaging Het
Sema4d C A 13: 51,879,347 (GRCm39) V7F probably benign Het
Sgip1 T C 4: 102,772,354 (GRCm39) probably benign Het
Sgpl1 C T 10: 60,949,216 (GRCm39) probably null Het
Shisa9 G A 16: 11,814,987 (GRCm39) V212M probably damaging Het
Shq1 G A 6: 100,550,588 (GRCm39) P450L probably benign Het
Sin3a A G 9: 57,018,196 (GRCm39) T872A probably benign Het
Sipa1l3 C T 7: 29,047,775 (GRCm39) R1371Q probably benign Het
Skint8 T C 4: 111,796,064 (GRCm39) V246A probably benign Het
Slc22a20 A T 19: 6,022,985 (GRCm39) V386D probably damaging Het
Slc28a2b A T 2: 122,348,034 (GRCm39) T253S probably benign Het
Slc2a7 G A 4: 150,242,528 (GRCm39) probably benign Het
Slc35a2 T A X: 7,755,901 (GRCm39) Y48N probably damaging Het
Slc4a2 G T 5: 24,639,344 (GRCm39) S413I probably damaging Het
Sntg2 T C 12: 30,276,772 (GRCm39) T427A probably benign Het
Soat1 T C 1: 156,270,023 (GRCm39) Y132C probably damaging Het
Stn1 G T 19: 47,490,112 (GRCm39) H342N probably benign Het
Tarbp1 T A 8: 127,165,667 (GRCm39) probably benign Het
Tas2r113 A C 6: 132,870,341 (GRCm39) K123T probably damaging Het
Tbck C T 3: 132,440,168 (GRCm39) Q504* probably null Het
Tenm3 C T 8: 48,794,069 (GRCm39) C380Y probably damaging Het
Tent4a A T 13: 69,648,051 (GRCm39) V781E possibly damaging Het
Triobp A G 15: 78,860,740 (GRCm39) D1389G probably damaging Het
Trpm4 A T 7: 44,958,130 (GRCm39) F780I probably damaging Het
Tubb4a G T 17: 57,388,182 (GRCm39) Y281* probably null Het
Txndc15 T C 13: 55,872,395 (GRCm39) F261S probably damaging Het
Ube3b T C 5: 114,557,530 (GRCm39) probably benign Het
Unc5c G C 3: 141,439,694 (GRCm39) V196L probably benign Het
Upf3a G A 8: 13,845,500 (GRCm39) probably null Het
Vmn2r20 T C 6: 123,363,063 (GRCm39) K574E probably benign Het
Vps50 A G 6: 3,536,853 (GRCm39) M275V possibly damaging Het
Xrcc5 A G 1: 72,346,735 (GRCm39) probably benign Het
Zbtb18 T C 1: 177,276,182 (GRCm39) L505S probably damaging Het
Zbtb41 T C 1: 139,366,722 (GRCm39) I567T probably damaging Het
Zfp598 T C 17: 24,897,558 (GRCm39) probably benign Het
Other mutations in Or6c6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01613:Or6c6c APN 10 129,541,492 (GRCm39) missense probably benign 0.01
IGL02041:Or6c6c APN 10 129,541,104 (GRCm39) missense probably damaging 1.00
IGL02245:Or6c6c APN 10 129,541,608 (GRCm39) missense probably damaging 1.00
IGL02341:Or6c6c APN 10 129,541,358 (GRCm39) missense probably damaging 0.99
IGL02433:Or6c6c APN 10 129,541,445 (GRCm39) missense probably benign 0.01
authen UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R0111:Or6c6c UTSW 10 129,541,146 (GRCm39) missense probably damaging 1.00
R0326:Or6c6c UTSW 10 129,541,638 (GRCm39) missense possibly damaging 0.69
R0374:Or6c6c UTSW 10 129,541,516 (GRCm39) missense probably benign 0.00
R1573:Or6c6c UTSW 10 129,541,487 (GRCm39) missense probably damaging 1.00
R1663:Or6c6c UTSW 10 129,541,160 (GRCm39) missense probably benign 0.44
R1778:Or6c6c UTSW 10 129,541,574 (GRCm39) missense probably benign 0.01
R1789:Or6c6c UTSW 10 129,541,476 (GRCm39) missense possibly damaging 0.82
R1906:Or6c6c UTSW 10 129,541,365 (GRCm39) missense probably benign 0.00
R2108:Or6c6c UTSW 10 129,541,490 (GRCm39) missense probably benign
R2211:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R2432:Or6c6c UTSW 10 129,540,794 (GRCm39) missense possibly damaging 0.91
R2902:Or6c6c UTSW 10 129,541,320 (GRCm39) missense probably benign
R4114:Or6c6c UTSW 10 129,541,668 (GRCm39) missense probably benign 0.00
R5149:Or6c6c UTSW 10 129,541,377 (GRCm39) missense probably benign 0.00
R5153:Or6c6c UTSW 10 129,541,026 (GRCm39) missense probably benign 0.05
R5846:Or6c6c UTSW 10 129,540,756 (GRCm39) missense probably damaging 0.99
R6553:Or6c6c UTSW 10 129,540,932 (GRCm39) missense probably benign 0.07
R7676:Or6c6c UTSW 10 129,541,155 (GRCm39) missense possibly damaging 0.63
R8161:Or6c6c UTSW 10 129,540,753 (GRCm39) missense possibly damaging 0.94
R9266:Or6c6c UTSW 10 129,541,547 (GRCm39) missense probably benign 0.17
R9318:Or6c6c UTSW 10 129,541,283 (GRCm39) missense probably benign 0.00
R9334:Or6c6c UTSW 10 129,541,683 (GRCm39) missense probably benign 0.00
R9746:Or6c6c UTSW 10 129,541,208 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGATGAGCTTGGTGGGGAACTTAATC -3'
(R):5'- TGGAATCACAGAAATCCAGCTTCAGAC -3'

Sequencing Primer
(F):5'- GGGAACTTAATCATTGTGCTTCTCAC -3'
(R):5'- AGTCACCCAGGAGCTGAG -3'
Posted On 2013-04-16