Incidental Mutation 'R2680:Nom1'
ID 250896
Institutional Source Beutler Lab
Gene Symbol Nom1
Ensembl Gene ENSMUSG00000001569
Gene Name nucleolar protein with MIF4G domain 1
Synonyms LOC381627, D5Kng1, Gm1040
MMRRC Submission 040433-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2680 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 29637338-29658504 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29648415 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 654 (F654S)
Ref Sequence ENSEMBL: ENSMUSP00000001611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001611]
AlphaFold Q3UFM5
Predicted Effect probably damaging
Transcript: ENSMUST00000001611
AA Change: F654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001611
Gene: ENSMUSG00000001569
AA Change: F654S

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 102 114 N/A INTRINSIC
low complexity region 119 147 N/A INTRINSIC
coiled coil region 170 197 N/A INTRINSIC
low complexity region 227 250 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
MIF4G 356 553 1.1e-21 SMART
MA3 649 755 1.59e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that contain MIF4G (middle of eIF4G (MIM 600495)) and/or MA3 domains, such as NOM1, function in protein translation. These domains include binding sites for members of the EIF4A family of ATP-dependent DEAD box RNA helicases (see EIF4A1; MIM 602641) (Simmons et al., 2005 [PubMed 15715967]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC024139 A G 15: 76,005,939 (GRCm39) W421R probably damaging Het
Car11 T C 7: 45,351,909 (GRCm39) S113P probably benign Het
Ccdc146 C T 5: 21,510,267 (GRCm39) A582T possibly damaging Het
Cct8l1 A G 5: 25,722,133 (GRCm39) T283A probably benign Het
Ckap5 A G 2: 91,419,043 (GRCm39) I1118V probably benign Het
Copa C T 1: 171,948,971 (GRCm39) Q1199* probably null Het
Cpd A T 11: 76,681,825 (GRCm39) N1140K probably benign Het
Cspp1 A G 1: 10,174,530 (GRCm39) D661G probably damaging Het
Dab2 A G 15: 6,466,474 (GRCm39) Q729R possibly damaging Het
Dnah9 T C 11: 65,924,751 (GRCm39) I2168V probably benign Het
Dync1h1 G A 12: 110,609,681 (GRCm39) R2821H probably damaging Het
Ercc5 T C 1: 44,196,133 (GRCm39) V42A probably benign Het
Evc A G 5: 37,467,581 (GRCm39) V566A probably benign Het
Fcrl2 T C 3: 87,164,656 (GRCm39) Y290C probably damaging Het
Frmd4a A G 2: 4,539,364 (GRCm39) R171G probably damaging Het
Galnt17 G A 5: 131,140,661 (GRCm39) P152L probably damaging Het
Gfi1 A G 5: 107,869,297 (GRCm39) L245P probably damaging Het
Heatr4 T C 12: 84,027,237 (GRCm39) K7E possibly damaging Het
Ifit3b A G 19: 34,589,705 (GRCm39) N294D probably benign Het
Ift74 A G 4: 94,541,265 (GRCm39) Y230C probably damaging Het
Igsf10 C T 3: 59,232,875 (GRCm39) V1953I probably benign Het
Ikzf5 T C 7: 130,998,490 (GRCm39) D14G probably damaging Het
Il12rb2 T A 6: 67,331,789 (GRCm39) T259S possibly damaging Het
Itgae T A 11: 73,005,752 (GRCm39) D305E probably damaging Het
Kif23 A C 9: 61,844,758 (GRCm39) D90E probably benign Het
Kprp A G 3: 92,731,770 (GRCm39) F427L unknown Het
Lmnb1 T A 18: 56,864,177 (GRCm39) Y261N probably damaging Het
Megf8 T C 7: 25,016,981 (GRCm39) V17A probably benign Het
Mfap4 T C 11: 61,378,057 (GRCm39) Y190H probably benign Het
Mlh1 T C 9: 111,065,085 (GRCm39) probably null Het
Mocos C A 18: 24,809,686 (GRCm39) Q430K probably damaging Het
Ndst2 A G 14: 20,774,822 (GRCm39) F794L probably damaging Het
Nedd4l A T 18: 65,296,201 (GRCm39) I197F possibly damaging Het
Nefm A G 14: 68,361,235 (GRCm39) L343P probably damaging Het
Nfatc4 A G 14: 56,070,291 (GRCm39) probably benign Het
Nlrp4a T A 7: 26,148,655 (GRCm39) probably null Het
Nlrp4f A T 13: 65,342,157 (GRCm39) L496* probably null Het
Or4k2 A T 14: 50,424,304 (GRCm39) Y123* probably null Het
Pcdhac2 A G 18: 37,278,639 (GRCm39) K540E possibly damaging Het
Pde4dip T C 3: 97,608,933 (GRCm39) N1974S possibly damaging Het
Pik3c3 T C 18: 30,477,131 (GRCm39) probably null Het
Pik3ca C T 3: 32,490,697 (GRCm39) R115* probably null Het
Pik3ca T C 3: 32,498,034 (GRCm39) I492T probably benign Het
Ppp1ca G A 19: 4,244,594 (GRCm39) E218K possibly damaging Het
Prex1 G T 2: 166,443,692 (GRCm39) D492E possibly damaging Het
Scaf8 T C 17: 3,247,866 (GRCm39) V1063A possibly damaging Het
Scn3a G T 2: 65,366,880 (GRCm39) N47K probably benign Het
Sec61a2 G T 2: 5,878,556 (GRCm39) N348K probably benign Het
Sh3rf2 A G 18: 42,234,715 (GRCm39) E166G probably damaging Het
Slc19a2 C A 1: 164,076,982 (GRCm39) T54K probably damaging Het
Slc8a3 T A 12: 81,249,113 (GRCm39) I765F probably damaging Het
Snap91 A T 9: 86,761,603 (GRCm39) M1K probably null Het
Spef1l T C 7: 139,558,474 (GRCm39) D41G probably damaging Het
Strc T C 2: 121,195,592 (GRCm39) H1619R probably damaging Het
Tbl1xr1 C T 3: 22,245,615 (GRCm39) T207M possibly damaging Het
Tchp T C 5: 114,847,580 (GRCm39) probably null Het
Tln1 A T 4: 43,539,668 (GRCm39) F1581Y probably damaging Het
Tnxb T C 17: 34,922,594 (GRCm39) V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn1r225 T A 17: 20,723,055 (GRCm39) F165L probably benign Het
Vmn2r13 T C 5: 109,322,178 (GRCm39) D173G possibly damaging Het
Vmn2r6 A C 3: 64,445,707 (GRCm39) S673A possibly damaging Het
Vta1 G A 10: 14,581,171 (GRCm39) probably benign Het
Wwc1 T C 11: 35,766,756 (GRCm39) T500A probably benign Het
Zfp784 T A 7: 5,039,116 (GRCm39) Q147H possibly damaging Het
Other mutations in Nom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Nom1 APN 5 29,651,272 (GRCm39) missense possibly damaging 0.74
IGL01795:Nom1 APN 5 29,651,869 (GRCm39) missense probably benign 0.06
IGL02308:Nom1 APN 5 29,642,708 (GRCm39) missense probably damaging 1.00
IGL02378:Nom1 APN 5 29,656,124 (GRCm39) nonsense probably null
IGL02506:Nom1 APN 5 29,644,814 (GRCm39) splice site probably benign
R0633:Nom1 UTSW 5 29,656,098 (GRCm39) missense probably damaging 1.00
R0652:Nom1 UTSW 5 29,640,309 (GRCm39) missense probably damaging 1.00
R1571:Nom1 UTSW 5 29,647,633 (GRCm39) nonsense probably null
R1707:Nom1 UTSW 5 29,640,316 (GRCm39) missense probably damaging 0.99
R1852:Nom1 UTSW 5 29,651,876 (GRCm39) missense possibly damaging 0.46
R2025:Nom1 UTSW 5 29,651,849 (GRCm39) missense probably damaging 1.00
R2196:Nom1 UTSW 5 29,641,019 (GRCm39) missense probably benign 0.00
R2207:Nom1 UTSW 5 29,644,972 (GRCm39) missense probably damaging 1.00
R2256:Nom1 UTSW 5 29,642,750 (GRCm39) missense probably damaging 1.00
R2257:Nom1 UTSW 5 29,642,750 (GRCm39) missense probably damaging 1.00
R3439:Nom1 UTSW 5 29,640,615 (GRCm39) missense probably benign 0.01
R4291:Nom1 UTSW 5 29,651,370 (GRCm39) critical splice donor site probably null
R4587:Nom1 UTSW 5 29,656,163 (GRCm39) missense possibly damaging 0.91
R5374:Nom1 UTSW 5 29,646,377 (GRCm39) missense probably damaging 1.00
R5761:Nom1 UTSW 5 29,642,639 (GRCm39) missense probably damaging 1.00
R5772:Nom1 UTSW 5 29,651,873 (GRCm39) missense possibly damaging 0.81
R5828:Nom1 UTSW 5 29,640,124 (GRCm39) missense possibly damaging 0.53
R5963:Nom1 UTSW 5 29,642,768 (GRCm39) missense probably damaging 1.00
R6208:Nom1 UTSW 5 29,654,617 (GRCm39) missense possibly damaging 0.83
R7234:Nom1 UTSW 5 29,640,451 (GRCm39) missense probably benign 0.01
R7476:Nom1 UTSW 5 29,647,534 (GRCm39) missense probably benign 0.29
R8848:Nom1 UTSW 5 29,645,137 (GRCm39) missense probably damaging 1.00
R9018:Nom1 UTSW 5 29,639,712 (GRCm39) missense possibly damaging 0.53
R9284:Nom1 UTSW 5 29,647,532 (GRCm39) missense probably damaging 0.99
R9390:Nom1 UTSW 5 29,639,766 (GRCm39) missense probably benign
R9608:Nom1 UTSW 5 29,642,750 (GRCm39) missense probably damaging 1.00
R9681:Nom1 UTSW 5 29,642,623 (GRCm39) missense probably damaging 0.99
Z1177:Nom1 UTSW 5 29,654,676 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACACAGTTTACAGTCACTTCTTC -3'
(R):5'- TCATGTGGAACCTGAAGCTC -3'

Sequencing Primer
(F):5'- GTCACTTCTTCAATAGTGACTGTTAC -3'
(R):5'- CTGAAGCTCAGGTAAGAGGGC -3'
Posted On 2014-12-04