Incidental Mutation 'R2680:Nom1'
List |< first << previous [record 39 of 66] next >> last >|
ID250896
Institutional Source Beutler Lab
Gene Symbol Nom1
Ensembl Gene ENSMUSG00000001569
Gene Namenucleolar protein with MIF4G domain 1
SynonymsGm1040, LOC381627, D5Kng1
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location29434664-29457843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29443417 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 654 (F654S)
Ref Sequence ENSEMBL: ENSMUSP00000001611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001611]
Predicted Effect probably damaging
Transcript: ENSMUST00000001611
AA Change: F654S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001611
Gene: ENSMUSG00000001569
AA Change: F654S

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 102 114 N/A INTRINSIC
low complexity region 119 147 N/A INTRINSIC
coiled coil region 170 197 N/A INTRINSIC
low complexity region 227 250 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
MIF4G 356 553 1.1e-21 SMART
MA3 649 755 1.59e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146347
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins that contain MIF4G (middle of eIF4G (MIM 600495)) and/or MA3 domains, such as NOM1, function in protein translation. These domains include binding sites for members of the EIF4A family of ATP-dependent DEAD box RNA helicases (see EIF4A1; MIM 602641) (Simmons et al., 2005 [PubMed 15715967]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Nom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:Nom1 APN 5 29446274 missense possibly damaging 0.74
IGL01795:Nom1 APN 5 29446871 missense probably benign 0.06
IGL02308:Nom1 APN 5 29437710 missense probably damaging 1.00
IGL02378:Nom1 APN 5 29451126 nonsense probably null
IGL02506:Nom1 APN 5 29439816 splice site probably benign
R0633:Nom1 UTSW 5 29451100 missense probably damaging 1.00
R0652:Nom1 UTSW 5 29435311 missense probably damaging 1.00
R1571:Nom1 UTSW 5 29442635 nonsense probably null
R1707:Nom1 UTSW 5 29435318 missense probably damaging 0.99
R1852:Nom1 UTSW 5 29446878 missense possibly damaging 0.46
R2025:Nom1 UTSW 5 29446851 missense probably damaging 1.00
R2196:Nom1 UTSW 5 29436021 missense probably benign 0.00
R2207:Nom1 UTSW 5 29439974 missense probably damaging 1.00
R2256:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R2257:Nom1 UTSW 5 29437752 missense probably damaging 1.00
R3439:Nom1 UTSW 5 29435617 missense probably benign 0.01
R4291:Nom1 UTSW 5 29446372 critical splice donor site probably null
R4587:Nom1 UTSW 5 29451165 missense possibly damaging 0.91
R5374:Nom1 UTSW 5 29441379 missense probably damaging 1.00
R5761:Nom1 UTSW 5 29437641 missense probably damaging 1.00
R5772:Nom1 UTSW 5 29446875 missense possibly damaging 0.81
R5828:Nom1 UTSW 5 29435126 missense possibly damaging 0.53
R5963:Nom1 UTSW 5 29437770 missense probably damaging 1.00
R6208:Nom1 UTSW 5 29449619 missense possibly damaging 0.83
R7234:Nom1 UTSW 5 29435453 missense probably benign 0.01
R7476:Nom1 UTSW 5 29442536 missense probably benign 0.29
Z1177:Nom1 UTSW 5 29449678 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACACAGTTTACAGTCACTTCTTC -3'
(R):5'- TCATGTGGAACCTGAAGCTC -3'

Sequencing Primer
(F):5'- GTCACTTCTTCAATAGTGACTGTTAC -3'
(R):5'- CTGAAGCTCAGGTAAGAGGGC -3'
Posted On2014-12-04