Incidental Mutation 'R2484:Arsi'
ID 250897
Institutional Source Beutler Lab
Gene Symbol Arsi
Ensembl Gene ENSMUSG00000036412
Gene Name arylsulfatase i
Synonyms
MMRRC Submission 040408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R2484 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 60911780-60918561 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60916651 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 202 (G202E)
Ref Sequence ENSEMBL: ENSMUSP00000043966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040359]
AlphaFold Q32KI9
Predicted Effect probably benign
Transcript: ENSMUST00000040359
AA Change: G202E

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043966
Gene: ENSMUSG00000036412
AA Change: G202E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Sulfatase 47 360 8.2e-73 PFAM
low complexity region 526 537 N/A INTRINSIC
low complexity region 547 556 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a large family of sulfatases that hydrolyze sulfate esters and sulfamates. Members of this family play a role in several cellular processes, including hormone synthesis, cell signaling in development and degradation of macromolecules. The protein encoded by this gene is thought to be secreted, and to function in extracellular space. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,641 N252S probably benign Het
4932414N04Rik G A 2: 68,711,475 D46N possibly damaging Het
A830018L16Rik G T 1: 11,596,302 A278S probably damaging Het
Adarb2 A T 13: 8,569,774 K99* probably null Het
Atxn1l A G 8: 109,732,251 S460P probably damaging Het
Bicra T A 7: 15,988,680 N304I possibly damaging Het
Capn10 A T 1: 92,944,843 D470V probably damaging Het
Chchd3 A G 6: 32,804,015 Y184H possibly damaging Het
Col6a6 T C 9: 105,780,804 I736M probably damaging Het
Dhx36 T A 3: 62,472,815 N820I probably damaging Het
Drd4 C T 7: 141,294,736 P347S probably benign Het
Ephx1 A T 1: 180,989,972 V378D probably damaging Het
Extl3 A T 14: 65,075,735 V666E probably damaging Het
Fam20c G C 5: 138,809,117 R500S probably benign Het
Glod4 A T 11: 76,239,518 D42E probably damaging Het
Golga2 T C 2: 32,304,770 I643T probably benign Het
Hnf1b A T 11: 83,861,835 T73S probably benign Het
Hydin A G 8: 110,513,115 Y2009C possibly damaging Het
Ido2 A G 8: 24,533,815 C336R probably damaging Het
Ifngr1 T C 10: 19,601,415 V108A probably damaging Het
Igbp1b A T 6: 138,657,494 N317K probably benign Het
Ints14 A G 9: 64,986,084 S511G probably benign Het
Itpr1 T C 6: 108,369,110 S125P probably damaging Het
Jag1 T C 2: 137,084,700 T975A possibly damaging Het
Klra17 A G 6: 129,868,757 W165R probably damaging Het
Leo1 T A 9: 75,445,473 N99K possibly damaging Het
Lonp1 C A 17: 56,614,659 G883C probably damaging Het
Lpin1 C A 12: 16,547,499 G682W probably damaging Het
Macf1 A C 4: 123,473,672 L2432R probably damaging Het
Med12l T G 3: 59,297,838 I2075M probably benign Het
Mroh6 A G 15: 75,884,328 S660P probably benign Het
Myh6 G T 14: 54,961,242 Y309* probably null Het
Myof C T 19: 37,903,843 R1154H probably benign Het
Myrip G A 9: 120,424,619 E253K probably benign Het
Ndst3 T C 3: 123,552,537 D281G possibly damaging Het
Nipbl T C 15: 8,323,698 K1788R probably damaging Het
Nol12 A G 15: 78,940,517 probably benign Het
Nptn A G 9: 58,643,673 T212A possibly damaging Het
Nptx2 C T 5: 144,556,345 A414V probably damaging Het
Nub1 A G 5: 24,708,702 D503G possibly damaging Het
Obscn T A 11: 59,007,540 probably benign Het
Olfr1253 A G 2: 89,752,234 I198T probably benign Het
Olfr1447 C T 19: 12,901,641 M46I probably benign Het
Olfr635 A G 7: 103,979,338 T49A probably benign Het
Pcnx2 T C 8: 125,891,120 E132G probably damaging Het
Pkdcc A G 17: 83,222,238 probably benign Het
Prdm2 T A 4: 143,135,206 I505F probably damaging Het
Psmc3 C G 2: 91,056,001 Q169E probably damaging Het
Ptger4 A T 15: 5,235,173 I334N probably benign Het
Ptrh1 T C 2: 32,777,171 M161T probably benign Het
Rapgef6 T A 11: 54,642,756 V482D possibly damaging Het
Rdh16f2 T C 10: 127,875,077 S188P probably damaging Het
Rrh T C 3: 129,822,391 Y31C probably damaging Het
Selp G T 1: 164,143,954 W659L probably benign Het
Selp G T 1: 164,143,955 W659C probably damaging Het
Shh A G 5: 28,466,742 C8R probably benign Het
Spdye4b C A 5: 143,202,093 S167R possibly damaging Het
Strip1 T C 3: 107,628,221 Y62C possibly damaging Het
Sucla2 A T 14: 73,581,709 I232F probably benign Het
Sugp1 A G 8: 70,069,524 D437G possibly damaging Het
Taf1a A G 1: 183,396,084 probably benign Het
Tbc1d20 T A 2: 152,311,363 M271K probably damaging Het
Tecpr2 T C 12: 110,933,318 S707P probably benign Het
Tert G A 13: 73,647,985 R1017H probably benign Het
Tox C G 4: 6,688,886 V493L probably damaging Het
Tpo C T 12: 30,103,969 A246T probably benign Het
Traf7 A T 17: 24,511,639 V358D probably damaging Het
Trim56 C T 5: 137,112,674 V663M possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usf3 C T 16: 44,220,682 H1842Y probably damaging Het
Uvrag T C 7: 98,888,461 E509G probably benign Het
Vmn2r5 T C 3: 64,503,971 D305G possibly damaging Het
Vmn2r52 T C 7: 10,169,131 R457G probably damaging Het
Vti1a A C 19: 55,380,979 N101T possibly damaging Het
Zfp236 A G 18: 82,668,637 F259L probably benign Het
Other mutations in Arsi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Arsi APN 18 60912430 missense probably damaging 1.00
IGL02519:Arsi APN 18 60917067 missense probably damaging 1.00
IGL03186:Arsi APN 18 60917473 missense probably damaging 1.00
IGL03134:Arsi UTSW 18 60917352 missense probably damaging 1.00
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0003:Arsi UTSW 18 60916986 missense probably benign 0.29
R0448:Arsi UTSW 18 60917302 missense probably damaging 0.98
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1147:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1148:Arsi UTSW 18 60916651 missense probably benign 0.07
R1190:Arsi UTSW 18 60916651 missense probably benign 0.07
R1261:Arsi UTSW 18 60916671 missense probably damaging 1.00
R1511:Arsi UTSW 18 60916651 missense probably benign 0.07
R1538:Arsi UTSW 18 60916651 missense probably benign 0.07
R1635:Arsi UTSW 18 60916651 missense probably benign 0.07
R1641:Arsi UTSW 18 60916651 missense probably benign 0.07
R1759:Arsi UTSW 18 60916651 missense probably benign 0.07
R1794:Arsi UTSW 18 60916651 missense probably benign 0.07
R1822:Arsi UTSW 18 60916651 missense probably benign 0.07
R1824:Arsi UTSW 18 60912297 missense probably damaging 1.00
R1824:Arsi UTSW 18 60916651 missense probably benign 0.07
R1930:Arsi UTSW 18 60916651 missense probably benign 0.07
R1932:Arsi UTSW 18 60916651 missense probably benign 0.07
R1983:Arsi UTSW 18 60916651 missense probably benign 0.07
R2035:Arsi UTSW 18 60916651 missense probably benign 0.07
R2036:Arsi UTSW 18 60916651 missense probably benign 0.07
R2108:Arsi UTSW 18 60916371 missense possibly damaging 0.75
R2166:Arsi UTSW 18 60916651 missense probably benign 0.07
R2168:Arsi UTSW 18 60916651 missense probably benign 0.07
R2261:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2263:Arsi UTSW 18 60916665 missense probably damaging 1.00
R2299:Arsi UTSW 18 60916651 missense probably benign 0.07
R2300:Arsi UTSW 18 60916651 missense probably benign 0.07
R2393:Arsi UTSW 18 60916651 missense probably benign 0.07
R2402:Arsi UTSW 18 60916467 missense possibly damaging 0.88
R2511:Arsi UTSW 18 60916594 missense probably damaging 1.00
R2994:Arsi UTSW 18 60916651 missense probably benign 0.07
R2995:Arsi UTSW 18 60916651 missense probably benign 0.07
R2996:Arsi UTSW 18 60916651 missense probably benign 0.07
R2997:Arsi UTSW 18 60916651 missense probably benign 0.07
R3625:Arsi UTSW 18 60916651 missense probably benign 0.07
R3694:Arsi UTSW 18 60916651 missense probably benign 0.07
R3695:Arsi UTSW 18 60916651 missense probably benign 0.07
R3883:Arsi UTSW 18 60916651 missense probably benign 0.07
R3884:Arsi UTSW 18 60916651 missense probably benign 0.07
R3907:Arsi UTSW 18 60916651 missense probably benign 0.07
R3932:Arsi UTSW 18 60916651 missense probably benign 0.07
R3954:Arsi UTSW 18 60916651 missense probably benign 0.07
R4212:Arsi UTSW 18 60916701 missense probably damaging 1.00
R4256:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4257:Arsi UTSW 18 60916651 missense probably benign 0.07
R4258:Arsi UTSW 18 60917316 missense probably damaging 1.00
R4459:Arsi UTSW 18 60916651 missense probably benign 0.07
R4469:Arsi UTSW 18 60916651 missense probably benign 0.07
R4601:Arsi UTSW 18 60916651 missense probably benign 0.07
R4603:Arsi UTSW 18 60916651 missense probably benign 0.07
R4610:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60916651 missense probably benign 0.07
R4649:Arsi UTSW 18 60917098 missense probably damaging 1.00
R4650:Arsi UTSW 18 60916651 missense probably benign 0.07
R4651:Arsi UTSW 18 60916651 missense probably benign 0.07
R4652:Arsi UTSW 18 60916651 missense probably benign 0.07
R4749:Arsi UTSW 18 60917461 missense probably benign 0.23
R4766:Arsi UTSW 18 60916651 missense probably benign 0.07
R4807:Arsi UTSW 18 60916651 missense probably benign 0.07
R4808:Arsi UTSW 18 60916651 missense probably benign 0.07
R4856:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4860:Arsi UTSW 18 60916651 missense probably benign 0.07
R4886:Arsi UTSW 18 60916651 missense probably benign 0.07
R5015:Arsi UTSW 18 60916651 missense probably benign 0.07
R5121:Arsi UTSW 18 60917439 missense probably damaging 1.00
R5185:Arsi UTSW 18 60916912 missense probably damaging 1.00
R6191:Arsi UTSW 18 60912472 missense probably damaging 1.00
R6197:Arsi UTSW 18 60916651 missense probably benign 0.07
R6218:Arsi UTSW 18 60916651 missense probably benign 0.07
R6219:Arsi UTSW 18 60916651 missense probably benign 0.07
R6220:Arsi UTSW 18 60916651 missense probably benign 0.07
R6378:Arsi UTSW 18 60916501 missense probably damaging 1.00
R6612:Arsi UTSW 18 60912456 missense probably benign 0.12
R6871:Arsi UTSW 18 60916651 missense probably benign 0.07
R7813:Arsi UTSW 18 60916654 missense possibly damaging 0.58
R7974:Arsi UTSW 18 60912406 missense probably damaging 1.00
R8035:Arsi UTSW 18 60916370 missense probably damaging 1.00
R9162:Arsi UTSW 18 60917497 missense probably damaging 0.96
R9200:Arsi UTSW 18 60916764 missense possibly damaging 0.87
R9581:Arsi UTSW 18 60917088 missense probably damaging 1.00
Z1176:Arsi UTSW 18 60916780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACAGGATTGCAGCACTCC -3'
(R):5'- TCACCATGGCTGCGTACTTG -3'

Sequencing Primer
(F):5'- AGGATTGCAGCACTCCATTATC -3'
(R):5'- TACTTGCGCCGTGCTACG -3'
Posted On 2014-12-04