Incidental Mutation 'R2680:Evc'
ID250898
Institutional Source Beutler Lab
Gene Symbol Evc
Ensembl Gene ENSMUSG00000029122
Gene NameEvC ciliary complex subunit 1
Synonyms
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location37289098-37336894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37310237 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 566 (V566A)
Ref Sequence ENSEMBL: ENSMUSP00000109791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031005] [ENSMUST00000114148] [ENSMUST00000114154] [ENSMUST00000146568]
Predicted Effect probably benign
Transcript: ENSMUST00000031005
AA Change: V743A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031005
Gene: ENSMUSG00000029122
AA Change: V743A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
coiled coil region 694 725 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
coiled coil region 871 911 N/A INTRINSIC
low complexity region 927 944 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114148
SMART Domains Protein: ENSMUSP00000109785
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114154
AA Change: V566A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122
AA Change: V566A

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146568
SMART Domains Protein: ENSMUSP00000114825
Gene: ENSMUSG00000029122

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
low complexity region 79 96 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154885
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some lethality shortly after birth and exhibit aphagia, infertile, teeth abnormalities, short limbs and long bones, delays in ossification, and short ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Evc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Evc APN 5 37333013 missense probably damaging 1.00
IGL01799:Evc APN 5 37324914 missense possibly damaging 0.46
IGL01806:Evc APN 5 37320234 critical splice donor site probably null
IGL01823:Evc APN 5 37328521 missense probably damaging 1.00
IGL02821:Evc APN 5 37326396 missense probably benign 0.01
R0312:Evc UTSW 5 37328541 missense possibly damaging 0.83
R0355:Evc UTSW 5 37316312 splice site probably benign
R0741:Evc UTSW 5 37326395 missense possibly damaging 0.51
R0745:Evc UTSW 5 37319059 missense probably damaging 0.99
R1498:Evc UTSW 5 37323700 missense possibly damaging 0.66
R1517:Evc UTSW 5 37319035 missense probably damaging 1.00
R2867:Evc UTSW 5 37316275 intron probably benign
R4585:Evc UTSW 5 37323713 missense probably damaging 0.96
R4586:Evc UTSW 5 37323713 missense probably damaging 0.96
R4731:Evc UTSW 5 37323797 missense probably benign 0.38
R4859:Evc UTSW 5 37300909 missense probably damaging 0.96
R4963:Evc UTSW 5 37322049 critical splice donor site probably null
R5536:Evc UTSW 5 37326583 splice site probably benign
R5693:Evc UTSW 5 37320240 missense possibly damaging 0.46
R5781:Evc UTSW 5 37326570 missense probably damaging 1.00
R6251:Evc UTSW 5 37300499 missense probably benign
R7061:Evc UTSW 5 37319102 missense possibly damaging 0.66
R7286:Evc UTSW 5 37322183 nonsense probably null
R7503:Evc UTSW 5 37300767 missense unknown
R7831:Evc UTSW 5 37319083 missense probably damaging 1.00
R8344:Evc UTSW 5 37314528 missense possibly damaging 0.90
R8853:Evc UTSW 5 37303303 missense possibly damaging 0.66
X0012:Evc UTSW 5 37300729 intron probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGCTGATTGGAGAAGC -3'
(R):5'- TGGAACACCCACCCTTTCAG -3'

Sequencing Primer
(F):5'- AGCTCAGGGCCTCTATGTG -3'
(R):5'- AGCCTCTCCCAGCCTTCAG -3'
Posted On2014-12-04