Incidental Mutation 'R2484:Olfr1447'
ID250901
Institutional Source Beutler Lab
Gene Symbol Olfr1447
Ensembl Gene ENSMUSG00000060303
Gene Nameolfactory receptor 1447
SynonymsGA_x6K02T2RE5P-3231251-3230331, MOR202-3
MMRRC Submission 040408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2484 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location12899434-12903743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12901641 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 46 (M46I)
Ref Sequence ENSEMBL: ENSMUSP00000147020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071484] [ENSMUST00000208343] [ENSMUST00000216989]
Predicted Effect probably benign
Transcript: ENSMUST00000071484
AA Change: M46I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071419
Gene: ENSMUSG00000060303
AA Change: M46I

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 5.3e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 306 2.1e-7 PFAM
Pfam:7tm_1 42 291 7.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208343
AA Change: M46I

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000216989
AA Change: M46I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220222
Meta Mutation Damage Score 0.2860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,882,641 N252S probably benign Het
4932414N04Rik G A 2: 68,711,475 D46N possibly damaging Het
A830018L16Rik G T 1: 11,596,302 A278S probably damaging Het
Adarb2 A T 13: 8,569,774 K99* probably null Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn1l A G 8: 109,732,251 S460P probably damaging Het
Bicra T A 7: 15,988,680 N304I possibly damaging Het
Capn10 A T 1: 92,944,843 D470V probably damaging Het
Chchd3 A G 6: 32,804,015 Y184H possibly damaging Het
Col6a6 T C 9: 105,780,804 I736M probably damaging Het
Dhx36 T A 3: 62,472,815 N820I probably damaging Het
Drd4 C T 7: 141,294,736 P347S probably benign Het
Ephx1 A T 1: 180,989,972 V378D probably damaging Het
Extl3 A T 14: 65,075,735 V666E probably damaging Het
Fam20c G C 5: 138,809,117 R500S probably benign Het
Glod4 A T 11: 76,239,518 D42E probably damaging Het
Golga2 T C 2: 32,304,770 I643T probably benign Het
Hnf1b A T 11: 83,861,835 T73S probably benign Het
Hydin A G 8: 110,513,115 Y2009C possibly damaging Het
Ido2 A G 8: 24,533,815 C336R probably damaging Het
Ifngr1 T C 10: 19,601,415 V108A probably damaging Het
Igbp1b A T 6: 138,657,494 N317K probably benign Het
Ints14 A G 9: 64,986,084 S511G probably benign Het
Itpr1 T C 6: 108,369,110 S125P probably damaging Het
Jag1 T C 2: 137,084,700 T975A possibly damaging Het
Klra17 A G 6: 129,868,757 W165R probably damaging Het
Leo1 T A 9: 75,445,473 N99K possibly damaging Het
Lonp1 C A 17: 56,614,659 G883C probably damaging Het
Lpin1 C A 12: 16,547,499 G682W probably damaging Het
Macf1 A C 4: 123,473,672 L2432R probably damaging Het
Med12l T G 3: 59,297,838 I2075M probably benign Het
Mroh6 A G 15: 75,884,328 S660P probably benign Het
Myh6 G T 14: 54,961,242 Y309* probably null Het
Myof C T 19: 37,903,843 R1154H probably benign Het
Myrip G A 9: 120,424,619 E253K probably benign Het
Ndst3 T C 3: 123,552,537 D281G possibly damaging Het
Nipbl T C 15: 8,323,698 K1788R probably damaging Het
Nol12 A G 15: 78,940,517 probably benign Het
Nptn A G 9: 58,643,673 T212A possibly damaging Het
Nptx2 C T 5: 144,556,345 A414V probably damaging Het
Nub1 A G 5: 24,708,702 D503G possibly damaging Het
Obscn T A 11: 59,007,540 probably benign Het
Olfr1253 A G 2: 89,752,234 I198T probably benign Het
Olfr635 A G 7: 103,979,338 T49A probably benign Het
Pcnx2 T C 8: 125,891,120 E132G probably damaging Het
Pkdcc A G 17: 83,222,238 probably benign Het
Prdm2 T A 4: 143,135,206 I505F probably damaging Het
Psmc3 C G 2: 91,056,001 Q169E probably damaging Het
Ptger4 A T 15: 5,235,173 I334N probably benign Het
Ptrh1 T C 2: 32,777,171 M161T probably benign Het
Rapgef6 T A 11: 54,642,756 V482D possibly damaging Het
Rdh16f2 T C 10: 127,875,077 S188P probably damaging Het
Rrh T C 3: 129,822,391 Y31C probably damaging Het
Selp G T 1: 164,143,954 W659L probably benign Het
Selp G T 1: 164,143,955 W659C probably damaging Het
Shh A G 5: 28,466,742 C8R probably benign Het
Spdye4b C A 5: 143,202,093 S167R possibly damaging Het
Strip1 T C 3: 107,628,221 Y62C possibly damaging Het
Sucla2 A T 14: 73,581,709 I232F probably benign Het
Sugp1 A G 8: 70,069,524 D437G possibly damaging Het
Taf1a A G 1: 183,396,084 probably benign Het
Tbc1d20 T A 2: 152,311,363 M271K probably damaging Het
Tecpr2 T C 12: 110,933,318 S707P probably benign Het
Tert G A 13: 73,647,985 R1017H probably benign Het
Tox C G 4: 6,688,886 V493L probably damaging Het
Tpo C T 12: 30,103,969 A246T probably benign Het
Traf7 A T 17: 24,511,639 V358D probably damaging Het
Trim56 C T 5: 137,112,674 V663M possibly damaging Het
Unc80 C T 1: 66,521,581 H823Y possibly damaging Het
Usf3 C T 16: 44,220,682 H1842Y probably damaging Het
Uvrag T C 7: 98,888,461 E509G probably benign Het
Vmn2r5 T C 3: 64,503,971 D305G possibly damaging Het
Vmn2r52 T C 7: 10,169,131 R457G probably damaging Het
Vti1a A C 19: 55,380,979 N101T possibly damaging Het
Zfp236 A G 18: 82,668,637 F259L probably benign Het
Other mutations in Olfr1447
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Olfr1447 APN 19 12901355 missense probably benign 0.40
IGL01704:Olfr1447 APN 19 12901739 missense probably benign 0.01
IGL01767:Olfr1447 APN 19 12901748 missense probably benign 0.12
IGL01969:Olfr1447 APN 19 12901052 missense possibly damaging 0.69
IGL02435:Olfr1447 APN 19 12901027 missense probably damaging 1.00
IGL02666:Olfr1447 APN 19 12900857 missense probably benign
IGL03034:Olfr1447 APN 19 12901757 missense possibly damaging 0.94
IGL03221:Olfr1447 APN 19 12901541 missense probably damaging 1.00
R0315:Olfr1447 UTSW 19 12901234 missense possibly damaging 0.66
R0550:Olfr1447 UTSW 19 12901800 splice site probably null
R0729:Olfr1447 UTSW 19 12900895 missense probably damaging 0.97
R1381:Olfr1447 UTSW 19 12900956 missense probably benign 0.00
R1669:Olfr1447 UTSW 19 12901288 missense possibly damaging 0.79
R1775:Olfr1447 UTSW 19 12901235 missense probably benign 0.02
R1918:Olfr1447 UTSW 19 12900851 makesense probably null
R2377:Olfr1447 UTSW 19 12900853 missense possibly damaging 0.45
R2406:Olfr1447 UTSW 19 12901627 missense probably benign 0.11
R2471:Olfr1447 UTSW 19 12901315 missense probably benign 0.00
R2656:Olfr1447 UTSW 19 12901666 missense probably benign 0.37
R3888:Olfr1447 UTSW 19 12901133 missense probably benign 0.00
R4250:Olfr1447 UTSW 19 12901004 missense probably benign 0.09
R4545:Olfr1447 UTSW 19 12901268 nonsense probably null
R4895:Olfr1447 UTSW 19 12900887 missense probably damaging 1.00
R4956:Olfr1447 UTSW 19 12901599 missense probably damaging 0.99
R4991:Olfr1447 UTSW 19 12901451 missense probably damaging 0.98
R5044:Olfr1447 UTSW 19 12901001 missense probably damaging 1.00
R5165:Olfr1447 UTSW 19 12901200 missense probably benign 0.00
R6025:Olfr1447 UTSW 19 12901670 missense probably benign 0.10
R6135:Olfr1447 UTSW 19 12901439 missense probably damaging 0.97
R6459:Olfr1447 UTSW 19 12901005 missense possibly damaging 0.94
R6733:Olfr1447 UTSW 19 12901241 missense probably damaging 1.00
R6789:Olfr1447 UTSW 19 12901289 missense probably benign 0.21
R6923:Olfr1447 UTSW 19 12901312 missense probably benign 0.04
R7310:Olfr1447 UTSW 19 12901273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTGAGCAGCACAATCATTG -3'
(R):5'- AAGCCCACACTAGTTTCCTG -3'

Sequencing Primer
(F):5'- GCACAATCATTGTAGGAAATGACC -3'
(R):5'- ACTACTTGGCATAGCTACTGAAGTGG -3'
Posted On2014-12-04