Incidental Mutation 'R2680:Gfi1'
List |< first << previous [record 18 of 66] next >> last >|
ID250902
Institutional Source Beutler Lab
Gene Symbol Gfi1
Ensembl Gene ENSMUSG00000029275
Gene Namegrowth factor independent 1
SynonymsPal-1, Gfi-1, Pal1
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2680 (G1)
Quality Score179
Status Not validated
Chromosome5
Chromosomal Location107716657-107726036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107721431 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 245 (L245P)
Ref Sequence ENSEMBL: ENSMUSP00000137229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031205] [ENSMUST00000065478] [ENSMUST00000159164] [ENSMUST00000159263]
Predicted Effect probably damaging
Transcript: ENSMUST00000031205
AA Change: L245P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135884
Gene: ENSMUSG00000029275
AA Change: L245P

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
low complexity region 184 202 N/A INTRINSIC
ZnF_C2H2 256 279 8.47e-4 SMART
ZnF_C2H2 285 307 1.82e-3 SMART
ZnF_C2H2 313 335 3.16e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2HC 342 358 5.37e0 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 420 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000065478
AA Change: L311P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135039
Gene: ENSMUSG00000029275
AA Change: L311P

DomainStartEndE-ValueType
low complexity region 6 24 N/A INTRINSIC
low complexity region 240 247 N/A INTRINSIC
low complexity region 250 268 N/A INTRINSIC
ZnF_C2H2 322 345 8.47e-4 SMART
ZnF_C2H2 351 373 1.82e-3 SMART
ZnF_C2H2 379 401 3.16e-3 SMART
ZnF_C2H2 407 429 3.89e-3 SMART
ZnF_C2HC 408 424 5.37e0 SMART
ZnF_C2H2 435 457 1.47e-3 SMART
ZnF_C2H2 463 486 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159164
AA Change: L245P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137229
Gene: ENSMUSG00000029275
AA Change: L245P

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
low complexity region 184 202 N/A INTRINSIC
ZnF_C2H2 256 279 8.47e-4 SMART
ZnF_C2H2 285 307 1.82e-3 SMART
ZnF_C2H2 313 335 3.16e-3 SMART
ZnF_C2H2 341 363 3.89e-3 SMART
ZnF_C2HC 342 358 5.37e0 SMART
ZnF_C2H2 369 391 1.47e-3 SMART
ZnF_C2H2 397 420 1.36e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159263
SMART Domains Protein: ENSMUSP00000135880
Gene: ENSMUSG00000029275

DomainStartEndE-ValueType
low complexity region 174 181 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear zinc finger protein that functions as a transcriptional repressor. This protein plays a role in diverse developmental contexts, including hematopoiesis and oncogenesis. It functions as part of a complex along with other cofactors to control histone modifications that lead to silencing of the target gene promoters. Mutations in this gene cause autosomal dominant severe congenital neutropenia, and also dominant nonimmune chronic idiopathic neutropenia of adults, which are heterogeneous hematopoietic disorders that cause predispositions to leukemias and infections. Multiple alternatively spliced variants, encoding the same protein, have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of inner ear hair cells, ataxia, circling, and deafness. Mutants also show a block in granulocyte and neutrophil maturation, and are hypersensitive to endotoxin stimulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Gfi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Gfi1 APN 5 107723722 splice site probably null
Pileup UTSW 5 107717768 missense probably damaging 1.00
Super8 UTSW 5 107720143 missense probably damaging 0.99
R1314:Gfi1 UTSW 5 107721874 splice site probably null
R2351:Gfi1 UTSW 5 107721774 missense probably damaging 1.00
R4687:Gfi1 UTSW 5 107723810 missense probably damaging 1.00
R4885:Gfi1 UTSW 5 107723286 missense probably damaging 1.00
R4951:Gfi1 UTSW 5 107720143 missense probably damaging 0.99
R5540:Gfi1 UTSW 5 107720125 missense probably damaging 0.99
R6193:Gfi1 UTSW 5 107721531 missense probably benign 0.45
R6782:Gfi1 UTSW 5 107725953 critical splice donor site probably null
R6993:Gfi1 UTSW 5 107717768 missense probably damaging 1.00
R7378:Gfi1 UTSW 5 107723229 missense possibly damaging 0.57
R7981:Gfi1 UTSW 5 107725677 intron probably benign
R8009:Gfi1 UTSW 5 107723801 missense probably damaging 1.00
R8821:Gfi1 UTSW 5 107720272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCTTGCCGCACATCTC -3'
(R):5'- CCTTTCAAGCCCTATGCATGGAG -3'

Sequencing Primer
(F):5'- ACGCAAAGGGTCTTGTGC -3'
(R):5'- ACCTGGTGCAGAGCTATCG -3'
Posted On2014-12-04