Incidental Mutation 'R2680:Vmn2r13'
ID 250904
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Name vomeronasal 2, receptor 13
Synonyms Gm4867
MMRRC Submission 040433-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R2680 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 109303889-109339973 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 109322178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 173 (D173G)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
AlphaFold L7N1X2
Predicted Effect possibly damaging
Transcript: ENSMUST00000053253
AA Change: D173G

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: D173G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC024139 A G 15: 76,005,939 (GRCm39) W421R probably damaging Het
Car11 T C 7: 45,351,909 (GRCm39) S113P probably benign Het
Ccdc146 C T 5: 21,510,267 (GRCm39) A582T possibly damaging Het
Cct8l1 A G 5: 25,722,133 (GRCm39) T283A probably benign Het
Ckap5 A G 2: 91,419,043 (GRCm39) I1118V probably benign Het
Copa C T 1: 171,948,971 (GRCm39) Q1199* probably null Het
Cpd A T 11: 76,681,825 (GRCm39) N1140K probably benign Het
Cspp1 A G 1: 10,174,530 (GRCm39) D661G probably damaging Het
Dab2 A G 15: 6,466,474 (GRCm39) Q729R possibly damaging Het
Dnah9 T C 11: 65,924,751 (GRCm39) I2168V probably benign Het
Dync1h1 G A 12: 110,609,681 (GRCm39) R2821H probably damaging Het
Ercc5 T C 1: 44,196,133 (GRCm39) V42A probably benign Het
Evc A G 5: 37,467,581 (GRCm39) V566A probably benign Het
Fcrl2 T C 3: 87,164,656 (GRCm39) Y290C probably damaging Het
Frmd4a A G 2: 4,539,364 (GRCm39) R171G probably damaging Het
Galnt17 G A 5: 131,140,661 (GRCm39) P152L probably damaging Het
Gfi1 A G 5: 107,869,297 (GRCm39) L245P probably damaging Het
Heatr4 T C 12: 84,027,237 (GRCm39) K7E possibly damaging Het
Ifit3b A G 19: 34,589,705 (GRCm39) N294D probably benign Het
Ift74 A G 4: 94,541,265 (GRCm39) Y230C probably damaging Het
Igsf10 C T 3: 59,232,875 (GRCm39) V1953I probably benign Het
Ikzf5 T C 7: 130,998,490 (GRCm39) D14G probably damaging Het
Il12rb2 T A 6: 67,331,789 (GRCm39) T259S possibly damaging Het
Itgae T A 11: 73,005,752 (GRCm39) D305E probably damaging Het
Kif23 A C 9: 61,844,758 (GRCm39) D90E probably benign Het
Kprp A G 3: 92,731,770 (GRCm39) F427L unknown Het
Lmnb1 T A 18: 56,864,177 (GRCm39) Y261N probably damaging Het
Megf8 T C 7: 25,016,981 (GRCm39) V17A probably benign Het
Mfap4 T C 11: 61,378,057 (GRCm39) Y190H probably benign Het
Mlh1 T C 9: 111,065,085 (GRCm39) probably null Het
Mocos C A 18: 24,809,686 (GRCm39) Q430K probably damaging Het
Ndst2 A G 14: 20,774,822 (GRCm39) F794L probably damaging Het
Nedd4l A T 18: 65,296,201 (GRCm39) I197F possibly damaging Het
Nefm A G 14: 68,361,235 (GRCm39) L343P probably damaging Het
Nfatc4 A G 14: 56,070,291 (GRCm39) probably benign Het
Nlrp4a T A 7: 26,148,655 (GRCm39) probably null Het
Nlrp4f A T 13: 65,342,157 (GRCm39) L496* probably null Het
Nom1 T C 5: 29,648,415 (GRCm39) F654S probably damaging Het
Or4k2 A T 14: 50,424,304 (GRCm39) Y123* probably null Het
Pcdhac2 A G 18: 37,278,639 (GRCm39) K540E possibly damaging Het
Pde4dip T C 3: 97,608,933 (GRCm39) N1974S possibly damaging Het
Pik3c3 T C 18: 30,477,131 (GRCm39) probably null Het
Pik3ca C T 3: 32,490,697 (GRCm39) R115* probably null Het
Pik3ca T C 3: 32,498,034 (GRCm39) I492T probably benign Het
Ppp1ca G A 19: 4,244,594 (GRCm39) E218K possibly damaging Het
Prex1 G T 2: 166,443,692 (GRCm39) D492E possibly damaging Het
Scaf8 T C 17: 3,247,866 (GRCm39) V1063A possibly damaging Het
Scn3a G T 2: 65,366,880 (GRCm39) N47K probably benign Het
Sec61a2 G T 2: 5,878,556 (GRCm39) N348K probably benign Het
Sh3rf2 A G 18: 42,234,715 (GRCm39) E166G probably damaging Het
Slc19a2 C A 1: 164,076,982 (GRCm39) T54K probably damaging Het
Slc8a3 T A 12: 81,249,113 (GRCm39) I765F probably damaging Het
Snap91 A T 9: 86,761,603 (GRCm39) M1K probably null Het
Spef1l T C 7: 139,558,474 (GRCm39) D41G probably damaging Het
Strc T C 2: 121,195,592 (GRCm39) H1619R probably damaging Het
Tbl1xr1 C T 3: 22,245,615 (GRCm39) T207M possibly damaging Het
Tchp T C 5: 114,847,580 (GRCm39) probably null Het
Tln1 A T 4: 43,539,668 (GRCm39) F1581Y probably damaging Het
Tnxb T C 17: 34,922,594 (GRCm39) V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Vmn1r225 T A 17: 20,723,055 (GRCm39) F165L probably benign Het
Vmn2r6 A C 3: 64,445,707 (GRCm39) S673A possibly damaging Het
Vta1 G A 10: 14,581,171 (GRCm39) probably benign Het
Wwc1 T C 11: 35,766,756 (GRCm39) T500A probably benign Het
Zfp784 T A 7: 5,039,116 (GRCm39) Q147H possibly damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109,303,964 (GRCm39) missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109,304,568 (GRCm39) missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109,322,085 (GRCm39) missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109,321,981 (GRCm39) missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109,339,883 (GRCm39) missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109,304,148 (GRCm39) missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109,319,645 (GRCm39) missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109,305,955 (GRCm39) missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109,304,398 (GRCm39) missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109,304,151 (GRCm39) missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109,304,332 (GRCm39) missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109,304,395 (GRCm39) missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109,321,679 (GRCm39) missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109,304,713 (GRCm39) missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109,322,068 (GRCm39) missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109,322,001 (GRCm39) missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109,306,040 (GRCm39) missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109,339,852 (GRCm39) missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109,339,943 (GRCm39) missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109,306,058 (GRCm39) missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109,306,058 (GRCm39) missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109,319,644 (GRCm39) missense probably benign 0.05
R2888:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109,339,840 (GRCm39) missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109,319,627 (GRCm39) missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109,304,721 (GRCm39) missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109,304,566 (GRCm39) missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109,304,322 (GRCm39) missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109,323,065 (GRCm39) missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109,304,331 (GRCm39) missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109,321,938 (GRCm39) missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109,322,915 (GRCm39) missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109,321,841 (GRCm39) missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109,339,805 (GRCm39) missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109,321,580 (GRCm39) missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109,339,860 (GRCm39) missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109,321,846 (GRCm39) missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109,321,966 (GRCm39) missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109,322,167 (GRCm39) missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109,321,982 (GRCm39) missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109,323,085 (GRCm39) missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109,304,540 (GRCm39) nonsense probably null
R6486:Vmn2r13 UTSW 5 109,304,425 (GRCm39) missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109,304,806 (GRCm39) splice site probably null
R6700:Vmn2r13 UTSW 5 109,322,938 (GRCm39) missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109,306,015 (GRCm39) missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109,304,753 (GRCm39) nonsense probably null
R7276:Vmn2r13 UTSW 5 109,321,645 (GRCm39) missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109,339,909 (GRCm39) missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109,339,909 (GRCm39) missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109,319,557 (GRCm39) splice site probably null
R7607:Vmn2r13 UTSW 5 109,321,506 (GRCm39) missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109,319,618 (GRCm39) missense probably benign 0.00
R8116:Vmn2r13 UTSW 5 109,322,926 (GRCm39) missense probably benign 0.12
R8242:Vmn2r13 UTSW 5 109,322,872 (GRCm39) missense possibly damaging 0.65
R8294:Vmn2r13 UTSW 5 109,322,978 (GRCm39) missense probably benign 0.02
R8340:Vmn2r13 UTSW 5 109,322,006 (GRCm39) missense probably benign 0.00
R8692:Vmn2r13 UTSW 5 109,319,514 (GRCm39) missense probably benign 0.03
R8742:Vmn2r13 UTSW 5 109,304,263 (GRCm39) missense probably benign 0.02
R9022:Vmn2r13 UTSW 5 109,304,242 (GRCm39) missense possibly damaging 0.94
R9281:Vmn2r13 UTSW 5 109,303,953 (GRCm39) missense probably damaging 1.00
R9529:Vmn2r13 UTSW 5 109,304,064 (GRCm39) missense probably damaging 1.00
R9708:Vmn2r13 UTSW 5 109,322,007 (GRCm39) missense probably benign 0.00
R9746:Vmn2r13 UTSW 5 109,339,773 (GRCm39) critical splice donor site probably null
X0066:Vmn2r13 UTSW 5 109,304,085 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCTAAACAGATTCCATCTCTTTGC -3'
(R):5'- ATACACTGGGCAAACAGGC -3'

Sequencing Primer
(F):5'- AAACAGATTCCATCTCTTTGCATTTC -3'
(R):5'- CAGGCAAAACTGTTTTCTAGGAC -3'
Posted On 2014-12-04