Incidental Mutation 'R2680:Vmn2r13'
List |< first << previous [record 62 of 66] next >> last >|
ID250904
Institutional Source Beutler Lab
Gene Symbol Vmn2r13
Ensembl Gene ENSMUSG00000091635
Gene Namevomeronasal 2, receptor 13
SynonymsGm4867
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location109156068-109192107 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109174312 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 173 (D173G)
Ref Sequence ENSEMBL: ENSMUSP00000052977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053253
AA Change: D173G

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000052977
Gene: ENSMUSG00000091635
AA Change: D173G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 76 463 2.8e-29 PFAM
Pfam:NCD3G 506 560 1.3e-18 PFAM
Pfam:7tm_3 593 828 1.8e-54 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Vmn2r13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Vmn2r13 APN 5 109156098 missense probably damaging 1.00
IGL01373:Vmn2r13 APN 5 109156702 missense probably damaging 1.00
IGL01946:Vmn2r13 APN 5 109174219 missense probably benign 0.01
IGL01971:Vmn2r13 APN 5 109174115 missense probably benign 0.01
IGL02636:Vmn2r13 APN 5 109192017 missense probably damaging 0.98
IGL03062:Vmn2r13 APN 5 109156282 missense probably damaging 1.00
IGL03173:Vmn2r13 APN 5 109171779 missense possibly damaging 0.95
IGL03301:Vmn2r13 APN 5 109158089 missense probably damaging 0.99
IGL03383:Vmn2r13 APN 5 109156532 missense probably damaging 0.98
IGL03048:Vmn2r13 UTSW 5 109156285 missense probably damaging 1.00
R0123:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0134:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0220:Vmn2r13 UTSW 5 109156466 missense probably damaging 1.00
R0225:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R0393:Vmn2r13 UTSW 5 109156529 missense probably benign 0.01
R0410:Vmn2r13 UTSW 5 109173813 missense probably benign 0.35
R0787:Vmn2r13 UTSW 5 109156847 missense probably damaging 0.99
R1200:Vmn2r13 UTSW 5 109174202 missense probably damaging 1.00
R1448:Vmn2r13 UTSW 5 109174135 missense probably damaging 1.00
R1782:Vmn2r13 UTSW 5 109158174 missense probably benign 0.08
R1939:Vmn2r13 UTSW 5 109191986 missense possibly damaging 0.88
R2029:Vmn2r13 UTSW 5 109192077 missense probably benign 0.13
R2125:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2126:Vmn2r13 UTSW 5 109158192 missense probably benign 0.00
R2379:Vmn2r13 UTSW 5 109171778 missense probably benign 0.05
R2888:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2889:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R2890:Vmn2r13 UTSW 5 109191974 missense possibly damaging 0.88
R3014:Vmn2r13 UTSW 5 109171761 missense possibly damaging 0.81
R3683:Vmn2r13 UTSW 5 109156855 missense probably damaging 1.00
R4074:Vmn2r13 UTSW 5 109156700 missense probably damaging 1.00
R4599:Vmn2r13 UTSW 5 109156456 missense probably damaging 1.00
R4614:Vmn2r13 UTSW 5 109175199 missense probably benign 0.01
R4805:Vmn2r13 UTSW 5 109156465 missense probably damaging 1.00
R4822:Vmn2r13 UTSW 5 109174072 missense probably damaging 0.99
R4943:Vmn2r13 UTSW 5 109175049 missense probably benign 0.00
R5263:Vmn2r13 UTSW 5 109173975 missense probably benign 0.00
R5297:Vmn2r13 UTSW 5 109191939 missense probably benign 0.00
R5502:Vmn2r13 UTSW 5 109173714 missense probably damaging 1.00
R5554:Vmn2r13 UTSW 5 109191994 missense possibly damaging 0.49
R5563:Vmn2r13 UTSW 5 109173980 missense probably benign 0.00
R5819:Vmn2r13 UTSW 5 109174100 missense possibly damaging 0.79
R6074:Vmn2r13 UTSW 5 109174301 missense probably benign 0.04
R6416:Vmn2r13 UTSW 5 109174116 missense probably damaging 0.99
R6419:Vmn2r13 UTSW 5 109175219 missense possibly damaging 0.87
R6484:Vmn2r13 UTSW 5 109156674 nonsense probably null
R6486:Vmn2r13 UTSW 5 109156559 missense probably benign 0.05
R6545:Vmn2r13 UTSW 5 109156940 splice site probably null
R6700:Vmn2r13 UTSW 5 109175072 missense probably benign 0.00
R6897:Vmn2r13 UTSW 5 109158149 missense possibly damaging 0.90
R6957:Vmn2r13 UTSW 5 109156887 nonsense probably null
R7276:Vmn2r13 UTSW 5 109173779 missense probably damaging 1.00
R7363:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7443:Vmn2r13 UTSW 5 109192043 missense probably benign 0.03
R7555:Vmn2r13 UTSW 5 109171691 splice site probably null
R7607:Vmn2r13 UTSW 5 109173640 missense probably damaging 0.98
R7719:Vmn2r13 UTSW 5 109171752 missense probably benign 0.00
R8116:Vmn2r13 UTSW 5 109175060 missense probably benign 0.12
R8242:Vmn2r13 UTSW 5 109175006 missense possibly damaging 0.65
R8294:Vmn2r13 UTSW 5 109175112 missense probably benign 0.02
R8340:Vmn2r13 UTSW 5 109174140 missense probably benign 0.00
R8692:Vmn2r13 UTSW 5 109171648 missense probably benign 0.03
R8742:Vmn2r13 UTSW 5 109156397 missense probably benign 0.02
X0066:Vmn2r13 UTSW 5 109156219 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCTAAACAGATTCCATCTCTTTGC -3'
(R):5'- ATACACTGGGCAAACAGGC -3'

Sequencing Primer
(F):5'- AAACAGATTCCATCTCTTTGCATTTC -3'
(R):5'- CAGGCAAAACTGTTTTCTAGGAC -3'
Posted On2014-12-04