Incidental Mutation 'R2495:Msc'
ID250907
Institutional Source Beutler Lab
Gene Symbol Msc
Ensembl Gene ENSMUSG00000025930
Gene Namemusculin
SynonymsbHLHa22, MyoR
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R2495 (G1)
Quality Score204
Status Validated
Chromosome1
Chromosomal Location14753346-14755992 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 14755249 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 167 (Y167S)
Ref Sequence ENSEMBL: ENSMUSP00000027062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027062] [ENSMUST00000190719]
Predicted Effect probably benign
Transcript: ENSMUST00000027062
AA Change: Y167S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027062
Gene: ENSMUSG00000025930
AA Change: Y167S

DomainStartEndE-ValueType
low complexity region 48 55 N/A INTRINSIC
low complexity region 66 94 N/A INTRINSIC
HLH 108 160 1.8e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000067599
SMART Domains Protein: ENSMUSP00000063770
Gene: ENSMUSG00000054493

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188982
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190471
Predicted Effect silent
Transcript: ENSMUST00000190719
SMART Domains Protein: ENSMUSP00000140741
Gene: ENSMUSG00000025930

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
Meta Mutation Damage Score 0.1588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional repressor capable of binding an E-box element either as a homodimer or as a heterodimer with E2A in vitro. The encoded protein also forms heterodimers with E2A proteins in vivo. This protein is capable of inhibiting the transactivation capability of E47, an E2A protein, in mammalian cells. This gene is a downstream target of the B-cell receptor signal transduction pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are obtained at predicted Mendelian ratios and exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Msc
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2081:Msc UTSW 1 14755717 missense probably benign 0.24
R2094:Msc UTSW 1 14755684 missense probably benign 0.27
R4409:Msc UTSW 1 14755678 missense probably damaging 0.97
R4470:Msc UTSW 1 14755678 missense probably damaging 0.97
R4471:Msc UTSW 1 14755678 missense probably damaging 0.97
R4654:Msc UTSW 1 14755829 splice site probably null
R5073:Msc UTSW 1 14754313 missense probably benign 0.02
R5385:Msc UTSW 1 14755420 missense probably damaging 1.00
R5399:Msc UTSW 1 14755556 missense probably benign 0.01
R6547:Msc UTSW 1 14755745 missense possibly damaging 0.95
R6799:Msc UTSW 1 14755267 missense probably damaging 0.99
Z1176:Msc UTSW 1 14755239 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGCCTTGATTCGGAGGTCAC -3'
(R):5'- CCAGCGACATTTCTTCTGCG -3'

Sequencing Primer
(F):5'- TTCGGAGGTCACTGAACCAGATTC -3'
(R):5'- CGCAGAGTGCAAGCAGTC -3'
Posted On2014-12-04