Mutagenetix > Incidental Mutations

Incidental Mutation 'R2495:Msc'

250907

Institutional Source

Beutler Lab

Gene Symbol

Msc

Ensembl Gene

ENSMUSG00000025930

Gene Name

musculin

Synonyms

bHLHa22, MyoR

MMRRC Submission

040409-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.281) question?

Stock #

R2495 (G1)

Quality Score

204

Status

Validated

Chromosome

Chromosomal Location

14753346-14755992 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 14755249 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 167 (Y167S)

Ref Sequence

ENSEMBL: ENSMUSP00000027062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027062] [ENSMUST00000190719]

Predicted Effect

probably benign
Transcript: ENSMUST00000027062
AA Change: Y167S

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000027062
Gene: ENSMUSG00000025930
AA Change: Y167S

Domain	Start	End	E-Value	Type
low complexity region	48	55	N/A	INTRINSIC
low complexity region	66	94	N/A	INTRINSIC
HLH	108	160	1.8e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000067599

SMART Domains

Protein: ENSMUSP00000063770
Gene: ENSMUSG00000054493

Domain	Start	End	E-Value	Type
low complexity region	15	23	N/A	INTRINSIC
low complexity region	106	124	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187401

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188982

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190471

Predicted Effect

silent
Transcript: ENSMUST00000190719

SMART Domains

Protein: ENSMUSP00000140741
Gene: ENSMUSG00000025930

Domain	Start	End	E-Value	Type
low complexity region	21	30	N/A	INTRINSIC

Meta Mutation Damage Score

0.1588

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional repressor capable of binding an E-box element either as a homodimer or as a heterodimer with E2A in vitro. The encoded protein also forms heterodimers with E2A proteins in vivo. This protein is capable of inhibiting the transactivation capability of E47, an E2A protein, in mammalian cells. This gene is a downstream target of the B-cell receptor signal transduction pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are obtained at predicted Mendelian ratios and exhibit no obvious phenotypic abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,481,960	F125S	unknown	Het
Abhd17c	C	T	7: 84,110,676	W290*	probably null	Het
Acsl5	A	T	19: 55,293,599	K536*	probably null	Het
Adamts14	A	T	10: 61,198,970		probably null	Het
Agbl3	A	G	6: 34,846,764	H788R	probably damaging	Het
Agrp	T	C	8: 105,566,776	N126D	possibly damaging	Het
Ambn	T	C	5: 88,467,804	I349T	probably benign	Het
Ank1	T	C	8: 23,132,264	W1610R	probably damaging	Het
Aox3	T	C	1: 58,188,408	L1224P	probably damaging	Het
Arhgef28	A	T	13: 98,029,373		probably benign	Het
Bcl11b	G	A	12: 107,915,447	H798Y	possibly damaging	Het
Capn11	T	A	17: 45,638,763	M426L	probably damaging	Het
Cep95	A	G	11: 106,809,282	K290E	possibly damaging	Het
Cic	A	G	7: 25,291,776		probably benign	Het
Cnbd1	A	T	4: 18,860,579	M389K	probably damaging	Het
Cnksr1	A	T	4: 134,232,162	L387Q	probably benign	Het
Cntrob	G	T	11: 69,322,923	P14T	probably damaging	Het
Crmp1	G	A	5: 37,246,097		probably null	Het
Dido1	A	G	2: 180,689,388	V89A	probably benign	Het
Dnah7a	T	A	1: 53,605,881	I999F	probably damaging	Het
Dsp	T	A	13: 38,193,477	L1746Q	possibly damaging	Het
Dst	T	C	1: 34,199,373	S3897P	probably damaging	Het
Fbxo10	A	G	4: 45,040,545	F887L	probably benign	Het
Gm21961	T	A	15: 65,014,873	H11L	unknown	Het
Gm4559	A	T	7: 142,273,820	C182S	unknown	Het
Gm5724	C	A	6: 141,765,777	M69I	probably benign	Het
Golga3	T	A	5: 110,207,596	S939T	probably damaging	Het
Got2	A	G	8: 95,888,290	S6P	possibly damaging	Het
Gpatch8	A	T	11: 102,478,481	H1410Q	probably damaging	Het
Gpx5	T	A	13: 21,291,440	T39S	probably benign	Het
Grin2b	T	C	6: 135,733,182	Y1122C	probably damaging	Het
Gsn	A	C	2: 35,303,193	N538T	probably damaging	Het
Helz2	A	G	2: 181,232,912	S1930P	probably damaging	Het
Krt6b	A	T	15: 101,678,322	F286Y	probably damaging	Het
Lrriq1	G	A	10: 103,202,381	R854C	probably damaging	Het
Mipol1	A	T	12: 57,460,990		probably benign	Het
Mmp19	A	G	10: 128,790,950		probably benign	Het
Mycbp2	T	G	14: 103,200,118	K2103Q	probably damaging	Het
Myh11	C	A	16: 14,205,557	D1586Y	probably damaging	Het
Nol6	A	T	4: 41,118,427	D791E	probably damaging	Het
Pcm1	A	G	8: 41,293,579	T1272A	probably benign	Het
Phgdh	A	G	3: 98,339,789	L15P	probably damaging	Het
Ptprk	A	T	10: 28,475,078		probably benign	Het
Ralgapa2	G	T	2: 146,361,400	D1091E	possibly damaging	Het
Rbbp8nl	C	A	2: 180,279,102	K496N	probably null	Het
Rbm26	T	C	14: 105,151,312		probably benign	Het
Rfx6	A	C	10: 51,726,675		probably benign	Het
Rras	G	A	7: 45,018,064	G17R	probably damaging	Het
Shisa6	G	A	11: 66,217,633	P473S	probably damaging	Het
Slc9a3	A	G	13: 74,158,703	K316E	probably damaging	Het
Spata31d1a	A	G	13: 59,701,993	S774P	possibly damaging	Het
Spsb4	T	C	9: 96,995,787	Y161C	probably damaging	Het
Taf3	G	T	2: 9,952,833	N174K	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Trnt1	T	A	6: 106,773,369	V78E	possibly damaging	Het
Ubox5	A	T	2: 130,599,521	C415*	probably null	Het
Ucn2	C	T	9: 108,986,409	P80S	possibly damaging	Het
Vmn2r10	G	A	5: 108,996,095	T663I	probably damaging	Het
Wdfy1	A	T	1: 79,707,505	F337L	probably null	Het
Zfp287	A	T	11: 62,714,633	C483S	probably damaging	Het
Zyg11b	A	G	4: 108,244,724		probably null	Het

Other mutations in Msc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R2081:Msc	UTSW	1	14755717	missense	probably benign	0.24
R2094:Msc	UTSW	1	14755684	missense	probably benign	0.27
R4409:Msc	UTSW	1	14755678	missense	probably damaging	0.97
R4470:Msc	UTSW	1	14755678	missense	probably damaging	0.97
R4471:Msc	UTSW	1	14755678	missense	probably damaging	0.97
R4654:Msc	UTSW	1	14755829	splice site	probably null
R5073:Msc	UTSW	1	14754313	missense	probably benign	0.02
R5385:Msc	UTSW	1	14755420	missense	probably damaging	1.00
R5399:Msc	UTSW	1	14755556	missense	probably benign	0.01
R6547:Msc	UTSW	1	14755745	missense	possibly damaging	0.95
R6799:Msc	UTSW	1	14755267	missense	probably damaging	0.99
Z1176:Msc	UTSW	1	14755239	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTTGCCTTGATTCGGAGGTCAC -3'
(R):5'- CCAGCGACATTTCTTCTGCG -3'

Sequencing Primer
(F):5'- TTCGGAGGTCACTGAACCAGATTC -3'
(R):5'- CGCAGAGTGCAAGCAGTC -3'

Posted On

2014-12-04