Incidental Mutation 'R2680:Il12rb2'
ID250910
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67354805 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 259 (T259S)
Ref Sequence ENSEMBL: ENSMUSP00000010605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018485
AA Change: T259S

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: T259S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67361905 missense probably benign 0.00
R0462:Il12rb2 UTSW 6 67303610 missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1559:Il12rb2 UTSW 6 67356592 missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4420:Il12rb2 UTSW 6 67316410 splice site probably null
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67292213 missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
R7361:Il12rb2 UTSW 6 67303466 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGTGTTTCCAGGCTAAAAGTTC -3'
(R):5'- GCAGTTATTTCAGTGGATGAGAAG -3'

Sequencing Primer
(F):5'- GTTTCCAGGCTAAAAGTTCTTAAAC -3'
(R):5'- CAACAGCTTTTGGGATAGCC -3'
Posted On2014-12-04