Incidental Mutation 'R2680:Car11'
ID250918
Institutional Source Beutler Lab
Gene Symbol Car11
Ensembl Gene ENSMUSG00000003273
Gene Namecarbonic anhydrase 11
SynonymsCA-RP XI
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45699843-45704682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45702485 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 113 (S113P)
Ref Sequence ENSEMBL: ENSMUSP00000003360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003360] [ENSMUST00000080885] [ENSMUST00000211357] [ENSMUST00000211513]
Predicted Effect probably benign
Transcript: ENSMUST00000003360
AA Change: S113P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000003360
Gene: ENSMUSG00000003273
AA Change: S113P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Carb_anhydrase 35 303 1.1e-62 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080885
SMART Domains Protein: ENSMUSP00000079693
Gene: ENSMUSG00000059824

DomainStartEndE-ValueType
low complexity region 10 31 N/A INTRINSIC
low complexity region 71 98 N/A INTRINSIC
low complexity region 127 171 N/A INTRINSIC
BRLZ 253 317 5.17e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137294
AA Change: S135P
Predicted Effect probably benign
Transcript: ENSMUST00000209796
Predicted Effect probably benign
Transcript: ENSMUST00000210027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211259
Predicted Effect probably benign
Transcript: ENSMUST00000211357
Predicted Effect probably benign
Transcript: ENSMUST00000211513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211748
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA XI is likely a secreted protein, however, radical changes at active site residues completely conserved in CA isozymes with catalytic activity, make it unlikely that it has carbonic anhydrase activity. It shares properties in common with two other acatalytic CA isoforms, CA VIII and CA X. CA XI is most abundantly expressed in brain, and may play a general role in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Car11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02195:Car11 APN 7 45701292 missense probably damaging 0.97
IGL03189:Car11 APN 7 45702455 missense probably damaging 0.98
R1201:Car11 UTSW 7 45703480 missense probably benign
R1625:Car11 UTSW 7 45701307 missense probably benign 0.04
R1670:Car11 UTSW 7 45703525 missense possibly damaging 0.52
R2430:Car11 UTSW 7 45703648 splice site probably null
R2509:Car11 UTSW 7 45701359 missense probably damaging 0.96
R2510:Car11 UTSW 7 45701359 missense probably damaging 0.96
R3926:Car11 UTSW 7 45700491 missense probably benign 0.17
R5511:Car11 UTSW 7 45700461 missense probably damaging 1.00
R5639:Car11 UTSW 7 45702621 critical splice donor site probably null
R7395:Car11 UTSW 7 45701321 nonsense probably null
R7490:Car11 UTSW 7 45700318 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGATATGGTCTGAGCCTGGG -3'
(R):5'- CGCACCAGGAATTAGTACTTAGG -3'

Sequencing Primer
(F):5'- GGAGTAGCTGATGCCCAAGC -3'
(R):5'- GAAACCAGGGTGATCTAGTGTTG -3'
Posted On2014-12-04