Mutagenetix > Incidental Mutation

Incidental Mutation 'R2680:Kif23'

250928

Institutional Source

Beutler Lab

Gene Symbol

Kif23

Ensembl Gene

ENSMUSG00000032254

Gene Name

kinesin family member 23

Synonyms

MKLP-1, Knsl5, C87313, 3110001D19Rik, MKLP1, CHO1

MMRRC Submission

040433-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R2680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

61915905-61946774 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 61937476 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 90 (D90E)

Ref Sequence

ENSEMBL: ENSMUSP00000034815 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034815] [ENSMUST00000214295]

AlphaFold

E9Q5G3

Predicted Effect

probably benign
Transcript: ENSMUST00000034815
AA Change: D90E

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034815
Gene: ENSMUSG00000032254
AA Change: D90E

Domain	Start	End	E-Value	Type
KISc	23	444	6.56e-147	SMART
Blast:KISc	524	607	8e-20	BLAST
low complexity region	661	678	N/A	INTRINSIC
low complexity region	681	693	N/A	INTRINSIC
low complexity region	715	728	N/A	INTRINSIC
Pfam:MKLP1_Arf_bdg	796	899	9.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213595

Predicted Effect

probably benign
Transcript: ENSMUST00000214295
AA Change: D90E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216717

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of kinesin-like protein family. This family includes microtubule-dependent molecular motors that transport organelles within cells and move chromosomes during cell division. This protein has been shown to cross-bridge antiparallel microtubules and drive microtubule movement in vitro. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	T	C	7: 139,978,561	D41G	probably damaging	Het
BC024139	A	G	15: 76,121,739	W421R	probably damaging	Het
Car11	T	C	7: 45,702,485	S113P	probably benign	Het
Ccdc146	C	T	5: 21,305,269	A582T	possibly damaging	Het
Cct8l1	A	G	5: 25,517,135	T283A	probably benign	Het
Ckap5	A	G	2: 91,588,698	I1118V	probably benign	Het
Copa	C	T	1: 172,121,404	Q1199*	probably null	Het
Cpd	A	T	11: 76,790,999	N1140K	probably benign	Het
Cspp1	A	G	1: 10,104,305	D661G	probably damaging	Het
Dab2	A	G	15: 6,436,993	Q729R	possibly damaging	Het
Dnah9	T	C	11: 66,033,925	I2168V	probably benign	Het
Dync1h1	G	A	12: 110,643,247	R2821H	probably damaging	Het
Ercc5	T	C	1: 44,156,973	V42A	probably benign	Het
Evc	A	G	5: 37,310,237	V566A	probably benign	Het
Fcrls	T	C	3: 87,257,349	Y290C	probably damaging	Het
Frmd4a	A	G	2: 4,534,553	R171G	probably damaging	Het
Galnt17	G	A	5: 131,111,823	P152L	probably damaging	Het
Gfi1	A	G	5: 107,721,431	L245P	probably damaging	Het
Heatr4	T	C	12: 83,980,463	K7E	possibly damaging	Het
Ifit3b	A	G	19: 34,612,305	N294D	probably benign	Het
Ift74	A	G	4: 94,653,028	Y230C	probably damaging	Het
Igsf10	C	T	3: 59,325,454	V1953I	probably benign	Het
Ikzf5	T	C	7: 131,396,761	D14G	probably damaging	Het
Il12rb2	T	A	6: 67,354,805	T259S	possibly damaging	Het
Itgae	T	A	11: 73,114,926	D305E	probably damaging	Het
Kprp	A	G	3: 92,824,463	F427L	unknown	Het
Lmnb1	T	A	18: 56,731,105	Y261N	probably damaging	Het
Megf8	T	C	7: 25,317,556	V17A	probably benign	Het
Mfap4	T	C	11: 61,487,231	Y190H	probably benign	Het
Mlh1	T	C	9: 111,236,017		probably null	Het
Mocos	C	A	18: 24,676,629	Q430K	probably damaging	Het
Ndst2	A	G	14: 20,724,754	F794L	probably damaging	Het
Nedd4l	A	T	18: 65,163,130	I197F	possibly damaging	Het
Nefm	A	G	14: 68,123,786	L343P	probably damaging	Het
Nfatc4	A	G	14: 55,832,834		probably benign	Het
Nlrp4a	T	A	7: 26,449,230		probably null	Het
Nlrp4f	A	T	13: 65,194,343	L496*	probably null	Het
Nom1	T	C	5: 29,443,417	F654S	probably damaging	Het
Olfr730	A	T	14: 50,186,847	Y123*	probably null	Het
Pcdhac2	A	G	18: 37,145,586	K540E	possibly damaging	Het
Pde4dip	T	C	3: 97,701,617	N1974S	possibly damaging	Het
Pik3c3	T	C	18: 30,344,078		probably null	Het
Pik3ca	C	T	3: 32,436,548	R115*	probably null	Het
Pik3ca	T	C	3: 32,443,885	I492T	probably benign	Het
Ppp1ca	G	A	19: 4,194,595	E218K	possibly damaging	Het
Prex1	G	T	2: 166,601,772	D492E	possibly damaging	Het
Scaf8	T	C	17: 3,197,591	V1063A	possibly damaging	Het
Scn3a	G	T	2: 65,536,536	N47K	probably benign	Het
Sec61a2	G	T	2: 5,873,745	N348K	probably benign	Het
Sh3rf2	A	G	18: 42,101,650	E166G	probably damaging	Het
Slc19a2	C	A	1: 164,249,413	T54K	probably damaging	Het
Slc8a3	T	A	12: 81,202,339	I765F	probably damaging	Het
Snap91	A	T	9: 86,879,550	M1K	probably null	Het
Strc	T	C	2: 121,365,111	H1619R	probably damaging	Het
Tbl1xr1	C	T	3: 22,191,451	T207M	possibly damaging	Het
Tchp	T	C	5: 114,709,519		probably null	Het
Tln1	A	T	4: 43,539,668	F1581Y	probably damaging	Het
Tnxb	T	C	17: 34,703,620	V2469A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r225	T	A	17: 20,502,793	F165L	probably benign	Het
Vmn2r13	T	C	5: 109,174,312	D173G	possibly damaging	Het
Vmn2r6	A	C	3: 64,538,286	S673A	possibly damaging	Het
Vta1	G	A	10: 14,705,427		probably benign	Het
Wwc1	T	C	11: 35,875,929	T500A	probably benign	Het
Zfp784	T	A	7: 5,036,117	Q147H	possibly damaging	Het

Other mutations in Kif23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Kif23	APN	9	61926468	missense	probably benign	0.19
IGL00814:Kif23	APN	9	61937107	missense	possibly damaging	0.95
IGL01295:Kif23	APN	9	61932129	missense	possibly damaging	0.89
IGL01521:Kif23	APN	9	61919900	missense	probably damaging	0.99
IGL01583:Kif23	APN	9	61935468	missense	probably damaging	1.00
IGL01680:Kif23	APN	9	61931814	missense	probably benign	0.17
IGL02450:Kif23	APN	9	61923957	missense	probably benign	0.00
IGL02698:Kif23	APN	9	61925001	missense	possibly damaging	0.49
IGL03152:Kif23	APN	9	61929776	splice site	probably benign
IGL03233:Kif23	APN	9	61926453	missense	probably benign	0.05
H8562:Kif23	UTSW	9	61924065	missense	probably benign
R0225:Kif23	UTSW	9	61925694	splice site	probably benign
R0419:Kif23	UTSW	9	61926405	nonsense	probably null
R0512:Kif23	UTSW	9	61918975	splice site	probably benign
R0731:Kif23	UTSW	9	61925032	missense	possibly damaging	0.67
R0980:Kif23	UTSW	9	61936764	missense	possibly damaging	0.93
R1315:Kif23	UTSW	9	61923988	splice site	probably null
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1347:Kif23	UTSW	9	61927156	missense	probably damaging	0.99
R1451:Kif23	UTSW	9	61924802	missense	probably damaging	1.00
R1624:Kif23	UTSW	9	61925700	splice site	probably null
R1820:Kif23	UTSW	9	61926438	missense	possibly damaging	0.67
R1867:Kif23	UTSW	9	61918961	missense	possibly damaging	0.87
R1937:Kif23	UTSW	9	61946610	critical splice donor site	probably null
R2001:Kif23	UTSW	9	61927384	nonsense	probably null
R2002:Kif23	UTSW	9	61927384	nonsense	probably null
R2310:Kif23	UTSW	9	61924144	missense	probably damaging	1.00
R3196:Kif23	UTSW	9	61931911	nonsense	probably null
R3774:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3775:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R3776:Kif23	UTSW	9	61924992	missense	probably benign	0.00
R4349:Kif23	UTSW	9	61932114	missense	probably damaging	1.00
R4671:Kif23	UTSW	9	61945359	missense	probably benign	0.04
R4981:Kif23	UTSW	9	61931871	missense	probably damaging	1.00
R4983:Kif23	UTSW	9	61936703	missense	probably benign	0.01
R5685:Kif23	UTSW	9	61945409	missense	probably benign	0.12
R5721:Kif23	UTSW	9	61944216	missense	probably benign	0.45
R6903:Kif23	UTSW	9	61927154	missense	possibly damaging	0.77
R7067:Kif23	UTSW	9	61924989	missense	probably benign	0.01
R7103:Kif23	UTSW	9	61919892	missense	probably damaging	0.99
R7456:Kif23	UTSW	9	61937120	missense	probably benign	0.09
R7468:Kif23	UTSW	9	61937175	nonsense	probably null
R8357:Kif23	UTSW	9	61927035	critical splice donor site	probably null
R8457:Kif23	UTSW	9	61927035	critical splice donor site	probably null
R8716:Kif23	UTSW	9	61937195	missense	probably damaging	1.00
R8783:Kif23	UTSW	9	61927571	missense	probably benign	0.00
R9028:Kif23	UTSW	9	61921059	missense	probably damaging	0.99
R9137:Kif23	UTSW	9	61927431	missense	probably damaging	0.97
R9283:Kif23	UTSW	9	61945369	missense	probably benign
R9430:Kif23	UTSW	9	61927440	missense	probably damaging	1.00
R9457:Kif23	UTSW	9	61944225	missense	probably benign	0.02
R9533:Kif23	UTSW	9	61925642	missense	probably benign
Z1177:Kif23	UTSW	9	61924163	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GTCCCACAGAACATTTCACTG -3'
(R):5'- GACTACTGAAGGCTCCAAGC -3'

Sequencing Primer
(F):5'- AGGGCATCACTCTAATGAG -3'
(R):5'- GCTCCAAGCATAAAGATCATTCTAGG -3'

Posted On

2014-12-04