Incidental Mutation 'R2495:Cnbd1'
ID250937
Institutional Source Beutler Lab
Gene Symbol Cnbd1
Ensembl Gene ENSMUSG00000073991
Gene Namecyclic nucleotide binding domain containing 1
Synonyms
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location18860454-19122526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18860579 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 389 (M389K)
Ref Sequence ENSEMBL: ENSMUSP00000121576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137780]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133363
Predicted Effect probably damaging
Transcript: ENSMUST00000137780
AA Change: M389K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121576
Gene: ENSMUSG00000073991
AA Change: M389K

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Blast:cNMP 166 225 6e-6 BLAST
SCOP:d1cx4a1 296 430 3e-13 SMART
Blast:cNMP 318 429 2e-60 BLAST
Meta Mutation Damage Score 0.1694 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Cnbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Cnbd1 APN 4 18906988 splice site probably benign
IGL01101:Cnbd1 APN 4 18907098 missense probably benign 0.30
IGL01365:Cnbd1 APN 4 18860576 missense probably damaging 1.00
IGL01646:Cnbd1 APN 4 18895141 nonsense probably null
IGL02106:Cnbd1 APN 4 18894993 missense possibly damaging 0.55
IGL02218:Cnbd1 APN 4 18887739 missense probably benign 0.00
IGL02335:Cnbd1 APN 4 19055095 missense possibly damaging 0.87
IGL02380:Cnbd1 APN 4 18887748 critical splice acceptor site probably null
IGL02380:Cnbd1 APN 4 18887749 critical splice acceptor site probably null
IGL02404:Cnbd1 APN 4 18895047 missense possibly damaging 0.64
IGL03293:Cnbd1 APN 4 18860565 missense possibly damaging 0.65
IGL03301:Cnbd1 APN 4 19055039 missense probably benign 0.00
IGL03342:Cnbd1 APN 4 19098264 splice site probably benign
IGL03392:Cnbd1 APN 4 18862111 missense probably damaging 1.00
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0195:Cnbd1 UTSW 4 18906988 splice site probably benign
R0462:Cnbd1 UTSW 4 18895044 missense probably benign 0.01
R0909:Cnbd1 UTSW 4 19122444 missense probably benign
R1435:Cnbd1 UTSW 4 18907026 missense probably benign 0.00
R1995:Cnbd1 UTSW 4 19055112 missense possibly damaging 0.55
R3974:Cnbd1 UTSW 4 18887693 missense probably benign 0.00
R4083:Cnbd1 UTSW 4 18886042 missense possibly damaging 0.88
R4494:Cnbd1 UTSW 4 19098150 missense probably benign 0.34
R4558:Cnbd1 UTSW 4 19055095 missense possibly damaging 0.87
R4833:Cnbd1 UTSW 4 18862120 missense probably damaging 0.97
R5326:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5542:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5930:Cnbd1 UTSW 4 18886119 missense probably benign 0.14
R5958:Cnbd1 UTSW 4 18862056 missense probably benign 0.31
R6064:Cnbd1 UTSW 4 18895084 missense probably benign 0.14
R6250:Cnbd1 UTSW 4 19098255 missense probably benign 0.00
R6348:Cnbd1 UTSW 4 18860462 missense probably damaging 0.99
R7027:Cnbd1 UTSW 4 18862063 missense probably benign 0.01
R7905:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
R7988:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CCCCAGTGATTAAATGGCCAAAG -3'
(R):5'- ATGGCAGTTTTGTCAGCTATCTTTC -3'

Sequencing Primer
(F):5'- TGGCCAAAGAGTTAAATGACATTC -3'
(R):5'- TCAGCTATCTTTCATATACTGAAGGG -3'
Posted On2014-12-04