Incidental Mutation 'R2495:Nol6'
ID250939
Institutional Source Beutler Lab
Gene Symbol Nol6
Ensembl Gene ENSMUSG00000028430
Gene Namenucleolar protein family 6 (RNA-associated)
SynonymsNrap
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location41114427-41124455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41118427 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 791 (D791E)
Ref Sequence ENSEMBL: ENSMUSP00000030138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030138]
Predicted Effect probably damaging
Transcript: ENSMUST00000030138
AA Change: D791E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: D791E

DomainStartEndE-ValueType
Pfam:Nrap 174 1145 5e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155315
Meta Mutation Damage Score 0.6666 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Nol6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nol6 APN 4 41123374 missense possibly damaging 0.89
IGL00787:Nol6 APN 4 41122198 missense probably benign 0.10
IGL01062:Nol6 APN 4 41118205 missense probably benign 0.13
IGL01113:Nol6 APN 4 41115749 missense probably damaging 1.00
IGL01874:Nol6 APN 4 41115412 missense probably damaging 1.00
IGL01995:Nol6 APN 4 41118567 missense probably damaging 1.00
IGL02060:Nol6 APN 4 41117700 missense probably damaging 1.00
IGL03082:Nol6 APN 4 41115878 splice site probably benign
IGL03221:Nol6 APN 4 41124166 missense probably benign 0.00
IGL03332:Nol6 APN 4 41120735 missense probably damaging 1.00
leaky UTSW 4 41118154 missense probably benign 0.02
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0066:Nol6 UTSW 4 41119572 splice site probably benign
R0308:Nol6 UTSW 4 41123584 missense probably benign 0.01
R0632:Nol6 UTSW 4 41121115 missense probably damaging 0.96
R1222:Nol6 UTSW 4 41120760 missense probably benign 0.01
R1471:Nol6 UTSW 4 41120281 missense probably benign 0.00
R1481:Nol6 UTSW 4 41123596 missense probably benign 0.00
R1971:Nol6 UTSW 4 41119542 missense probably damaging 1.00
R2191:Nol6 UTSW 4 41118720 missense probably benign 0.00
R3852:Nol6 UTSW 4 41117452 missense probably damaging 0.99
R3923:Nol6 UTSW 4 41121531 missense probably benign 0.17
R4458:Nol6 UTSW 4 41115888 missense probably damaging 1.00
R4510:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4511:Nol6 UTSW 4 41123526 missense probably damaging 1.00
R4575:Nol6 UTSW 4 41120299 missense probably benign 0.00
R4637:Nol6 UTSW 4 41121788 missense probably damaging 0.99
R4700:Nol6 UTSW 4 41118944 missense possibly damaging 0.58
R4820:Nol6 UTSW 4 41121508 missense probably damaging 1.00
R4975:Nol6 UTSW 4 41120167 missense probably benign 0.00
R5395:Nol6 UTSW 4 41118392 intron probably benign
R5826:Nol6 UTSW 4 41122158 missense probably benign 0.04
R6531:Nol6 UTSW 4 41118154 missense probably benign 0.02
R6943:Nol6 UTSW 4 41118962 missense probably damaging 1.00
R7001:Nol6 UTSW 4 41121279 missense probably benign 0.00
R7035:Nol6 UTSW 4 41118479 missense probably benign 0.01
R7282:Nol6 UTSW 4 41119468 missense probably benign 0.18
R7327:Nol6 UTSW 4 41116686 missense probably benign 0.34
R7402:Nol6 UTSW 4 41118699 missense probably damaging 1.00
R7483:Nol6 UTSW 4 41117424 missense possibly damaging 0.92
R7505:Nol6 UTSW 4 41120352 missense probably damaging 1.00
R7669:Nol6 UTSW 4 41118717 missense probably damaging 0.97
R8255:Nol6 UTSW 4 41120168 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCTGTGGAGAGATGTGGC -3'
(R):5'- ATGACTGGTAAGAGGGTCCTTG -3'

Sequencing Primer
(F):5'- TGTGGCAAAGGAAATGAATGTC -3'
(R):5'- GCTGCGGAATCAGATCTCTCAC -3'
Posted On2014-12-04