Mutagenetix > Incidental Mutation

Incidental Mutation 'R2495:Nol6'

250939

Institutional Source

Beutler Lab

Gene Symbol

Nol6

Ensembl Gene

ENSMUSG00000028430

Gene Name

nucleolar protein family 6 (RNA-associated)

Synonyms

Nrap

MMRRC Submission

040409-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R2495 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41114427-41124455 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 41118427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 791 (D791E)

Ref Sequence

ENSEMBL: ENSMUSP00000030138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030138]

AlphaFold

Q8R5K4

Predicted Effect

probably damaging
Transcript: ENSMUST00000030138
AA Change: D791E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030138
Gene: ENSMUSG00000028430
AA Change: D791E

Domain	Start	End	E-Value	Type
Pfam:Nrap	174	1145	5e-287	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129112

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135059

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155315

Meta Mutation Damage Score

0.6666

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nucleolus is a dense subnuclear membraneless organelle that assembles around clusters of rRNA genes and functions in ribosome biogenesis. This gene encodes a nucleolar RNA-associated protein that is highly conserved between species. RNase treatment of permeabilized cells indicates that the nucleolar localization is RNA dependent. Further studies suggest that the protein is associated with ribosome biogenesis through an interaction with pre-rRNA primary transcripts. Alternative splicing has been observed at this locus and two splice variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810062G17Rik	T	C	3: 36,481,960	F125S	unknown	Het
Abhd17c	C	T	7: 84,110,676	W290*	probably null	Het
Acsl5	A	T	19: 55,293,599	K536*	probably null	Het
Adamts14	A	T	10: 61,198,970		probably null	Het
Agbl3	A	G	6: 34,846,764	H788R	probably damaging	Het
Agrp	T	C	8: 105,566,776	N126D	possibly damaging	Het
Ambn	T	C	5: 88,467,804	I349T	probably benign	Het
Ank1	T	C	8: 23,132,264	W1610R	probably damaging	Het
Aox3	T	C	1: 58,188,408	L1224P	probably damaging	Het
Arhgef28	A	T	13: 98,029,373		probably benign	Het
Bcl11b	G	A	12: 107,915,447	H798Y	possibly damaging	Het
Capn11	T	A	17: 45,638,763	M426L	probably damaging	Het
Cep95	A	G	11: 106,809,282	K290E	possibly damaging	Het
Cic	A	G	7: 25,291,776		probably benign	Het
Cnbd1	A	T	4: 18,860,579	M389K	probably damaging	Het
Cnksr1	A	T	4: 134,232,162	L387Q	probably benign	Het
Cntrob	G	T	11: 69,322,923	P14T	probably damaging	Het
Crmp1	G	A	5: 37,246,097		probably null	Het
Dido1	A	G	2: 180,689,388	V89A	probably benign	Het
Dnah7a	T	A	1: 53,605,881	I999F	probably damaging	Het
Dsp	T	A	13: 38,193,477	L1746Q	possibly damaging	Het
Dst	T	C	1: 34,199,373	S3897P	probably damaging	Het
Fbxo10	A	G	4: 45,040,545	F887L	probably benign	Het
Gm21961	T	A	15: 65,014,873	H11L	unknown	Het
Gm4559	A	T	7: 142,273,820	C182S	unknown	Het
Gm5724	C	A	6: 141,765,777	M69I	probably benign	Het
Golga3	T	A	5: 110,207,596	S939T	probably damaging	Het
Got2	A	G	8: 95,888,290	S6P	possibly damaging	Het
Gpatch8	A	T	11: 102,478,481	H1410Q	probably damaging	Het
Gpx5	T	A	13: 21,291,440	T39S	probably benign	Het
Grin2b	T	C	6: 135,733,182	Y1122C	probably damaging	Het
Gsn	A	C	2: 35,303,193	N538T	probably damaging	Het
Helz2	A	G	2: 181,232,912	S1930P	probably damaging	Het
Krt6b	A	T	15: 101,678,322	F286Y	probably damaging	Het
Lrriq1	G	A	10: 103,202,381	R854C	probably damaging	Het
Mipol1	A	T	12: 57,460,990		probably benign	Het
Mmp19	A	G	10: 128,790,950		probably benign	Het
Msc	T	G	1: 14,755,249	Y167S	probably benign	Het
Mycbp2	T	G	14: 103,200,118	K2103Q	probably damaging	Het
Myh11	C	A	16: 14,205,557	D1586Y	probably damaging	Het
Pcm1	A	G	8: 41,293,579	T1272A	probably benign	Het
Phgdh	A	G	3: 98,339,789	L15P	probably damaging	Het
Ptprk	A	T	10: 28,475,078		probably benign	Het
Ralgapa2	G	T	2: 146,361,400	D1091E	possibly damaging	Het
Rbbp8nl	C	A	2: 180,279,102	K496N	probably null	Het
Rbm26	T	C	14: 105,151,312		probably benign	Het
Rfx6	A	C	10: 51,726,675		probably benign	Het
Rras	G	A	7: 45,018,064	G17R	probably damaging	Het
Shisa6	G	A	11: 66,217,633	P473S	probably damaging	Het
Slc9a3	A	G	13: 74,158,703	K316E	probably damaging	Het
Spata31d1a	A	G	13: 59,701,993	S774P	possibly damaging	Het
Spsb4	T	C	9: 96,995,787	Y161C	probably damaging	Het
Taf3	G	T	2: 9,952,833	N174K	probably damaging	Het
Tectb	C	G	19: 55,180,999		probably benign	Het
Trnt1	T	A	6: 106,773,369	V78E	possibly damaging	Het
Ubox5	A	T	2: 130,599,521	C415*	probably null	Het
Ucn2	C	T	9: 108,986,409	P80S	possibly damaging	Het
Vmn2r10	G	A	5: 108,996,095	T663I	probably damaging	Het
Wdfy1	A	T	1: 79,707,505	F337L	probably null	Het
Zfp287	A	T	11: 62,714,633	C483S	probably damaging	Het
Zyg11b	A	G	4: 108,244,724		probably null	Het

Other mutations in Nol6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nol6	APN	4	41123374	missense	possibly damaging	0.89
IGL00787:Nol6	APN	4	41122198	missense	probably benign	0.10
IGL01062:Nol6	APN	4	41118205	missense	probably benign	0.13
IGL01113:Nol6	APN	4	41115749	missense	probably damaging	1.00
IGL01874:Nol6	APN	4	41115412	missense	probably damaging	1.00
IGL01995:Nol6	APN	4	41118567	missense	probably damaging	1.00
IGL02060:Nol6	APN	4	41117700	missense	probably damaging	1.00
IGL03082:Nol6	APN	4	41115878	splice site	probably benign
IGL03221:Nol6	APN	4	41124166	missense	probably benign	0.00
IGL03332:Nol6	APN	4	41120735	missense	probably damaging	1.00
leaky	UTSW	4	41118154	missense	probably benign	0.02
R0066:Nol6	UTSW	4	41119572	splice site	probably benign
R0066:Nol6	UTSW	4	41119572	splice site	probably benign
R0308:Nol6	UTSW	4	41123584	missense	probably benign	0.01
R0632:Nol6	UTSW	4	41121115	missense	probably damaging	0.96
R1222:Nol6	UTSW	4	41120760	missense	probably benign	0.01
R1471:Nol6	UTSW	4	41120281	missense	probably benign	0.00
R1481:Nol6	UTSW	4	41123596	missense	probably benign	0.00
R1971:Nol6	UTSW	4	41119542	missense	probably damaging	1.00
R2191:Nol6	UTSW	4	41118720	missense	probably benign	0.00
R3852:Nol6	UTSW	4	41117452	missense	probably damaging	0.99
R3923:Nol6	UTSW	4	41121531	missense	probably benign	0.17
R4458:Nol6	UTSW	4	41115888	missense	probably damaging	1.00
R4510:Nol6	UTSW	4	41123526	missense	probably damaging	1.00
R4511:Nol6	UTSW	4	41123526	missense	probably damaging	1.00
R4575:Nol6	UTSW	4	41120299	missense	probably benign	0.00
R4637:Nol6	UTSW	4	41121788	missense	probably damaging	0.99
R4700:Nol6	UTSW	4	41118944	missense	possibly damaging	0.58
R4820:Nol6	UTSW	4	41121508	missense	probably damaging	1.00
R4975:Nol6	UTSW	4	41120167	missense	probably benign	0.00
R5395:Nol6	UTSW	4	41118392	intron	probably benign
R5826:Nol6	UTSW	4	41122158	missense	probably benign	0.04
R6531:Nol6	UTSW	4	41118154	missense	probably benign	0.02
R6943:Nol6	UTSW	4	41118962	missense	probably damaging	1.00
R7001:Nol6	UTSW	4	41121279	missense	probably benign	0.00
R7035:Nol6	UTSW	4	41118479	missense	probably benign	0.01
R7282:Nol6	UTSW	4	41119468	missense	probably benign	0.18
R7327:Nol6	UTSW	4	41116686	missense	probably benign	0.34
R7402:Nol6	UTSW	4	41118699	missense	probably damaging	1.00
R7483:Nol6	UTSW	4	41117424	missense	possibly damaging	0.92
R7505:Nol6	UTSW	4	41120352	missense	probably damaging	1.00
R7669:Nol6	UTSW	4	41118717	missense	probably damaging	0.97
R8255:Nol6	UTSW	4	41120168	missense	probably benign	0.01
R8401:Nol6	UTSW	4	41119548	missense	possibly damaging	0.87
R8426:Nol6	UTSW	4	41119870	missense	probably benign	0.36
R8826:Nol6	UTSW	4	41121823	missense	probably benign	0.26
R9228:Nol6	UTSW	4	41116422	missense	probably benign	0.42
R9259:Nol6	UTSW	4	41118229	missense	possibly damaging	0.84
R9571:Nol6	UTSW	4	41120156	missense	probably benign	0.00
R9604:Nol6	UTSW	4	41120298	missense	probably benign	0.05
R9748:Nol6	UTSW	4	41123538	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCCTGTGGAGAGATGTGGC -3'
(R):5'- ATGACTGGTAAGAGGGTCCTTG -3'

Sequencing Primer
(F):5'- TGTGGCAAAGGAAATGAATGTC -3'
(R):5'- GCTGCGGAATCAGATCTCTCAC -3'

Posted On

2014-12-04