Incidental Mutation 'R2680:Mfap4'
ID250940
Institutional Source Beutler Lab
Gene Symbol Mfap4
Ensembl Gene ENSMUSG00000042436
Gene Namemicrofibrillar-associated protein 4
Synonyms1110007F23Rik
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61485431-61488900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61487231 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 190 (Y190H)
Ref Sequence ENSEMBL: ENSMUSP00000038971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
Predicted Effect probably benign
Transcript: ENSMUST00000040522
AA Change: Y190H

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436
AA Change: Y190H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064783
AA Change: Y166H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436
AA Change: Y166H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079080
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101085
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108714
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152755
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to a bovine microfibril-associated protein. The protein has binding specificities for both collagen and carbohydrate. It is thought to be an extracellular matrix protein which is involved in cell adhesion or intercellular interactions. The gene is located within the Smith-Magenis syndrome region. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spontaneous air space enlargement in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Mfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Mfap4 APN 11 61487781 missense possibly damaging 0.94
IGL01482:Mfap4 APN 11 61487757 missense probably damaging 1.00
R0512:Mfap4 UTSW 11 61487945 missense probably damaging 1.00
R0631:Mfap4 UTSW 11 61487180 missense probably damaging 0.99
R1991:Mfap4 UTSW 11 61485807 critical splice donor site probably null
R4614:Mfap4 UTSW 11 61485509 unclassified probably benign
R4616:Mfap4 UTSW 11 61485509 unclassified probably benign
R4617:Mfap4 UTSW 11 61485509 unclassified probably benign
R4675:Mfap4 UTSW 11 61485510 unclassified probably benign
R4987:Mfap4 UTSW 11 61486082 missense probably benign 0.14
R5381:Mfap4 UTSW 11 61487930 missense probably benign 0.06
R6173:Mfap4 UTSW 11 61485419 unclassified probably null
R7640:Mfap4 UTSW 11 61487087 missense probably damaging 1.00
R7695:Mfap4 UTSW 11 61485719 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAGCCAAGTCTCTGCTGAC -3'
(R):5'- GGGCCAATCCTACGTTACTGAC -3'

Sequencing Primer
(F):5'- AAGTCTCTGCTGACCGGCTG -3'
(R):5'- ACTGATCCTACCCCTTACTG -3'
Posted On2014-12-04