Incidental Mutation 'R2495:Fbxo10'
ID250941
Institutional Source Beutler Lab
Gene Symbol Fbxo10
Ensembl Gene ENSMUSG00000048232
Gene NameF-box protein 10
SynonymsFBX10, LOC269529
MMRRC Submission 040409-MU
Accession Numbers

Genbank: NM_001024142; MGI: 2686937  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45034247-45084604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45040545 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 887 (F887L)
Ref Sequence ENSEMBL: ENSMUSP00000058233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052236] [ENSMUST00000107814]
Predicted Effect probably benign
Transcript: ENSMUST00000052236
AA Change: F887L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058233
Gene: ENSMUSG00000048232
AA Change: F887L

DomainStartEndE-ValueType
FBOX 6 48 1.92e-6 SMART
PbH1 198 217 8.34e3 SMART
PbH1 238 260 1.37e3 SMART
CASH 337 511 7.29e-6 SMART
PbH1 423 444 1.41e2 SMART
PbH1 467 489 1.33e3 SMART
PbH1 490 512 1.32e2 SMART
PbH1 513 535 8.34e3 SMART
PbH1 536 558 2.87e1 SMART
CASH 536 672 5.49e1 SMART
PbH1 559 581 1.25e1 SMART
PbH1 582 604 2.64e2 SMART
PbH1 605 627 6.05e3 SMART
PbH1 628 650 2.46e2 SMART
PbH1 651 673 2.14e2 SMART
CASH 681 804 6.58e1 SMART
PbH1 713 735 6.52e2 SMART
PbH1 736 758 5.92e2 SMART
PbH1 760 782 1.13e3 SMART
PbH1 783 805 1.86e2 SMART
PbH1 828 850 9.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107814
SMART Domains Protein: ENSMUSP00000103444
Gene: ENSMUSG00000028318

DomainStartEndE-ValueType
Pfam:RNA_pol_I_A49 49 385 4.1e-105 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000140008
AA Change: F713L
SMART Domains Protein: ENSMUSP00000119862
Gene: ENSMUSG00000048232
AA Change: F713L

DomainStartEndE-ValueType
PbH1 25 44 8.34e3 SMART
PbH1 65 87 1.37e3 SMART
CASH 164 338 7.29e-6 SMART
PbH1 250 271 1.41e2 SMART
PbH1 294 316 1.33e3 SMART
PbH1 317 339 1.32e2 SMART
PbH1 340 362 8.34e3 SMART
PbH1 363 385 2.87e1 SMART
CASH 363 499 5.49e1 SMART
PbH1 386 408 1.25e1 SMART
PbH1 409 431 2.64e2 SMART
PbH1 432 454 6.05e3 SMART
PbH1 455 477 2.46e2 SMART
PbH1 478 500 2.14e2 SMART
CASH 508 631 6.58e1 SMART
PbH1 540 562 6.52e2 SMART
PbH1 563 585 5.92e2 SMART
PbH1 587 609 1.13e3 SMART
PbH1 610 632 1.86e2 SMART
PbH1 655 677 9.32e1 SMART
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO10, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Fbxo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Fbxo10 APN 4 45058684 missense probably damaging 0.98
IGL02073:Fbxo10 APN 4 45046349 missense possibly damaging 0.94
IGL02097:Fbxo10 APN 4 45048527 missense probably benign 0.24
IGL02315:Fbxo10 APN 4 45062469 missense probably benign 0.08
IGL02403:Fbxo10 APN 4 45062517 missense probably benign 0.01
IGL02408:Fbxo10 APN 4 45058361 missense possibly damaging 0.75
IGL02496:Fbxo10 APN 4 45043883 missense probably damaging 1.00
IGL02583:Fbxo10 APN 4 45044754 missense probably damaging 1.00
IGL02794:Fbxo10 APN 4 45041928 missense probably benign 0.20
N/A - 287:Fbxo10 UTSW 4 45044708 splice site probably benign
R1033:Fbxo10 UTSW 4 45062236 missense probably damaging 1.00
R1102:Fbxo10 UTSW 4 45043672 missense probably damaging 1.00
R1583:Fbxo10 UTSW 4 45062118 missense probably damaging 1.00
R1586:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R1789:Fbxo10 UTSW 4 45046389 missense probably damaging 1.00
R2187:Fbxo10 UTSW 4 45058531 missense probably benign 0.09
R2191:Fbxo10 UTSW 4 45044811 missense probably damaging 1.00
R2377:Fbxo10 UTSW 4 45044719 missense probably benign 0.18
R2425:Fbxo10 UTSW 4 45051642 missense possibly damaging 0.60
R4105:Fbxo10 UTSW 4 45059054 missense probably benign 0.01
R4472:Fbxo10 UTSW 4 45043693 missense probably damaging 1.00
R4480:Fbxo10 UTSW 4 45048470 missense probably damaging 1.00
R4985:Fbxo10 UTSW 4 45040692 missense probably benign 0.33
R5193:Fbxo10 UTSW 4 45051573 nonsense probably null
R5309:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5312:Fbxo10 UTSW 4 45042036 missense possibly damaging 0.82
R5348:Fbxo10 UTSW 4 45058934 missense probably damaging 1.00
R5694:Fbxo10 UTSW 4 45035970 missense probably damaging 1.00
R5844:Fbxo10 UTSW 4 45058760 missense probably benign 0.09
R5974:Fbxo10 UTSW 4 45040631 missense probably benign 0.18
R5990:Fbxo10 UTSW 4 45061960 missense probably damaging 1.00
R6197:Fbxo10 UTSW 4 45043857 missense probably benign 0.03
R6359:Fbxo10 UTSW 4 45041796 missense possibly damaging 0.93
R6808:Fbxo10 UTSW 4 45059035 missense probably benign 0.00
R6873:Fbxo10 UTSW 4 45041787 missense possibly damaging 0.94
R6921:Fbxo10 UTSW 4 45044849 missense probably damaging 1.00
R7089:Fbxo10 UTSW 4 45062230 missense possibly damaging 0.90
R7120:Fbxo10 UTSW 4 45040533 nonsense probably null
R7498:Fbxo10 UTSW 4 45062194 missense probably benign 0.04
R7872:Fbxo10 UTSW 4 45051699 missense not run
R8022:Fbxo10 UTSW 4 45062062 missense possibly damaging 0.93
R8161:Fbxo10 UTSW 4 45044793 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAAGCAATGTTCCAGGCC -3'
(R):5'- TGACTTGCACCAGCTTGTG -3'

Sequencing Primer
(F):5'- TGTTCCAGGCCAACTACAACTG -3'
(R):5'- GGTCTCTGAGCTATGACAAGTCC -3'
Posted On2014-12-04