Incidental Mutation 'R2495:Zyg11b'
ID 250943
Institutional Source Beutler Lab
Gene Symbol Zyg11b
Ensembl Gene ENSMUSG00000034636
Gene Name zyg-ll family member B, cell cycle regulator
Synonyms 1110046I03Rik, LOC242610, 2810482G21Rik, D4Mgi23
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock # R2495 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 108229724-108301096 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 108244724 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043616]
AlphaFold Q3UFS0
Predicted Effect probably null
Transcript: ENSMUST00000043616
SMART Domains Protein: ENSMUSP00000043844
Gene: ENSMUSG00000034636

DomainStartEndE-ValueType
SCOP:d1jdha_ 370 722 3e-16 SMART
Blast:ARM 480 526 1e-17 BLAST
Blast:ARM 528 570 3e-19 BLAST
Blast:ARM 638 679 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130508
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Other mutations in Zyg11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Zyg11b APN 4 108237416 missense probably damaging 1.00
IGL01143:Zyg11b APN 4 108244994 missense possibly damaging 0.69
IGL01627:Zyg11b APN 4 108250788 missense probably benign 0.19
IGL02517:Zyg11b APN 4 108266318 missense probably damaging 0.96
IGL03166:Zyg11b APN 4 108265889 missense probably benign 0.32
R0326:Zyg11b UTSW 4 108272253 missense possibly damaging 0.77
R0345:Zyg11b UTSW 4 108266407 missense probably damaging 1.00
R0396:Zyg11b UTSW 4 108255308 missense probably damaging 1.00
R0571:Zyg11b UTSW 4 108260042 missense probably damaging 1.00
R0718:Zyg11b UTSW 4 108242076 missense possibly damaging 0.94
R1426:Zyg11b UTSW 4 108250812 missense probably damaging 1.00
R1495:Zyg11b UTSW 4 108266213 missense probably damaging 1.00
R1829:Zyg11b UTSW 4 108266093 missense possibly damaging 0.65
R1907:Zyg11b UTSW 4 108255226 missense probably damaging 1.00
R1916:Zyg11b UTSW 4 108272283 missense probably damaging 0.99
R1980:Zyg11b UTSW 4 108265930 missense probably damaging 0.99
R2070:Zyg11b UTSW 4 108250819 missense possibly damaging 0.73
R4717:Zyg11b UTSW 4 108241872 missense probably damaging 0.99
R5889:Zyg11b UTSW 4 108237380 nonsense probably null
R5957:Zyg11b UTSW 4 108245013 missense probably damaging 1.00
R6606:Zyg11b UTSW 4 108236089 missense probably benign 0.00
R7151:Zyg11b UTSW 4 108244922 missense possibly damaging 0.49
R7316:Zyg11b UTSW 4 108250502 missense possibly damaging 0.81
R7488:Zyg11b UTSW 4 108266458 missense possibly damaging 0.65
R8936:Zyg11b UTSW 4 108252159 missense
R9291:Zyg11b UTSW 4 108250817 missense probably benign 0.37
X0022:Zyg11b UTSW 4 108236101 missense probably benign
X0067:Zyg11b UTSW 4 108255346 missense probably benign
Z1177:Zyg11b UTSW 4 108255364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTCCTGGGTACTGAGCTAT -3'
(R):5'- CTCTTCATGAGGGTTCTAGAGGT -3'

Sequencing Primer
(F):5'- ATGGTGGCTCACAACCATCTG -3'
(R):5'- TCTAGAGGTGAGAATGGAAATTTACC -3'
Posted On 2014-12-04