Mutagenetix > Incidental Mutation

Incidental Mutation 'R2680:Itgae'

250944

Institutional Source

Beutler Lab

Gene Symbol

Itgae

Ensembl Gene

ENSMUSG00000005947

Gene Name

integrin alpha E, epithelial-associated

Synonyms

CD103, alpha-E1

MMRRC Submission

040433-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

73090583-73147446 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73114926 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 305 (D305E)

Ref Sequence

ENSEMBL: ENSMUSP00000099596 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]

AlphaFold

Q60677

Predicted Effect

probably damaging
Transcript: ENSMUST00000006101
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	1e-24	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART
transmembrane domain	1115	1137	N/A	INTRINSIC
Pfam:Integrin_alpha	1138	1152	1.1e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102537
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D305E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:Int_alpha	36	118	5e-25	BLAST
VWA	193	380	1.13e-39	SMART
Int_alpha	448	496	1.49e-3	SMART
Int_alpha	502	559	6.83e-12	SMART
Int_alpha	565	626	1.79e-15	SMART
Int_alpha	633	685	6.29e0	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	T	C	7: 139,978,561 (GRCm38)	D41G	probably damaging	Het
BC024139	A	G	15: 76,121,739 (GRCm38)	W421R	probably damaging	Het
Car11	T	C	7: 45,702,485 (GRCm38)	S113P	probably benign	Het
Ccdc146	C	T	5: 21,305,269 (GRCm38)	A582T	possibly damaging	Het
Cct8l1	A	G	5: 25,517,135 (GRCm38)	T283A	probably benign	Het
Ckap5	A	G	2: 91,588,698 (GRCm38)	I1118V	probably benign	Het
Copa	C	T	1: 172,121,404 (GRCm38)	Q1199*	probably null	Het
Cpd	A	T	11: 76,790,999 (GRCm38)	N1140K	probably benign	Het
Cspp1	A	G	1: 10,104,305 (GRCm38)	D661G	probably damaging	Het
Dab2	A	G	15: 6,436,993 (GRCm38)	Q729R	possibly damaging	Het
Dnah9	T	C	11: 66,033,925 (GRCm38)	I2168V	probably benign	Het
Dync1h1	G	A	12: 110,643,247 (GRCm38)	R2821H	probably damaging	Het
Ercc5	T	C	1: 44,156,973 (GRCm38)	V42A	probably benign	Het
Evc	A	G	5: 37,310,237 (GRCm38)	V566A	probably benign	Het
Fcrls	T	C	3: 87,257,349 (GRCm38)	Y290C	probably damaging	Het
Frmd4a	A	G	2: 4,534,553 (GRCm38)	R171G	probably damaging	Het
Galnt17	G	A	5: 131,111,823 (GRCm38)	P152L	probably damaging	Het
Gfi1	A	G	5: 107,721,431 (GRCm38)	L245P	probably damaging	Het
Heatr4	T	C	12: 83,980,463 (GRCm38)	K7E	possibly damaging	Het
Ifit3b	A	G	19: 34,612,305 (GRCm38)	N294D	probably benign	Het
Ift74	A	G	4: 94,653,028 (GRCm38)	Y230C	probably damaging	Het
Igsf10	C	T	3: 59,325,454 (GRCm38)	V1953I	probably benign	Het
Ikzf5	T	C	7: 131,396,761 (GRCm38)	D14G	probably damaging	Het
Il12rb2	T	A	6: 67,354,805 (GRCm38)	T259S	possibly damaging	Het
Kif23	A	C	9: 61,937,476 (GRCm38)	D90E	probably benign	Het
Kprp	A	G	3: 92,824,463 (GRCm38)	F427L	unknown	Het
Lmnb1	T	A	18: 56,731,105 (GRCm38)	Y261N	probably damaging	Het
Megf8	T	C	7: 25,317,556 (GRCm38)	V17A	probably benign	Het
Mfap4	T	C	11: 61,487,231 (GRCm38)	Y190H	probably benign	Het
Mlh1	T	C	9: 111,236,017 (GRCm38)		probably null	Het
Mocos	C	A	18: 24,676,629 (GRCm38)	Q430K	probably damaging	Het
Ndst2	A	G	14: 20,724,754 (GRCm38)	F794L	probably damaging	Het
Nedd4l	A	T	18: 65,163,130 (GRCm38)	I197F	possibly damaging	Het
Nefm	A	G	14: 68,123,786 (GRCm38)	L343P	probably damaging	Het
Nfatc4	A	G	14: 55,832,834 (GRCm38)		probably benign	Het
Nlrp4a	T	A	7: 26,449,230 (GRCm38)		probably null	Het
Nlrp4f	A	T	13: 65,194,343 (GRCm38)	L496*	probably null	Het
Nom1	T	C	5: 29,443,417 (GRCm38)	F654S	probably damaging	Het
Olfr730	A	T	14: 50,186,847 (GRCm38)	Y123*	probably null	Het
Pcdhac2	A	G	18: 37,145,586 (GRCm38)	K540E	possibly damaging	Het
Pde4dip	T	C	3: 97,701,617 (GRCm38)	N1974S	possibly damaging	Het
Pik3c3	T	C	18: 30,344,078 (GRCm38)		probably null	Het
Pik3ca	T	C	3: 32,443,885 (GRCm38)	I492T	probably benign	Het
Pik3ca	C	T	3: 32,436,548 (GRCm38)	R115*	probably null	Het
Ppp1ca	G	A	19: 4,194,595 (GRCm38)	E218K	possibly damaging	Het
Prex1	G	T	2: 166,601,772 (GRCm38)	D492E	possibly damaging	Het
Scaf8	T	C	17: 3,197,591 (GRCm38)	V1063A	possibly damaging	Het
Scn3a	G	T	2: 65,536,536 (GRCm38)	N47K	probably benign	Het
Sec61a2	G	T	2: 5,873,745 (GRCm38)	N348K	probably benign	Het
Sh3rf2	A	G	18: 42,101,650 (GRCm38)	E166G	probably damaging	Het
Slc19a2	C	A	1: 164,249,413 (GRCm38)	T54K	probably damaging	Het
Slc8a3	T	A	12: 81,202,339 (GRCm38)	I765F	probably damaging	Het
Snap91	A	T	9: 86,879,550 (GRCm38)	M1K	probably null	Het
Strc	T	C	2: 121,365,111 (GRCm38)	H1619R	probably damaging	Het
Tbl1xr1	C	T	3: 22,191,451 (GRCm38)	T207M	possibly damaging	Het
Tchp	T	C	5: 114,709,519 (GRCm38)		probably null	Het
Tln1	A	T	4: 43,539,668 (GRCm38)	F1581Y	probably damaging	Het
Tnxb	T	C	17: 34,703,620 (GRCm38)	V2469A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798 (GRCm38)	P46S	probably benign	Het
Vmn1r225	T	A	17: 20,502,793 (GRCm38)	F165L	probably benign	Het
Vmn2r13	T	C	5: 109,174,312 (GRCm38)	D173G	possibly damaging	Het
Vmn2r6	A	C	3: 64,538,286 (GRCm38)	S673A	possibly damaging	Het
Vta1	G	A	10: 14,705,427 (GRCm38)		probably benign	Het
Wwc1	T	C	11: 35,875,929 (GRCm38)	T500A	probably benign	Het
Zfp784	T	A	7: 5,036,117 (GRCm38)	Q147H	possibly damaging	Het

Other mutations in Itgae

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Itgae	APN	11	73,145,635 (GRCm38)	missense	probably benign	0.17
IGL00472:Itgae	APN	11	73,113,694 (GRCm38)	missense	probably benign	0.06
IGL00821:Itgae	APN	11	73,123,148 (GRCm38)	missense	probably damaging	1.00
IGL01625:Itgae	APN	11	73,119,437 (GRCm38)	missense	probably benign	0.00
IGL01639:Itgae	APN	11	73,119,378 (GRCm38)	missense	probably benign	0.00
IGL01743:Itgae	APN	11	73,111,759 (GRCm38)	missense	probably benign	0.02
IGL01911:Itgae	APN	11	73,116,137 (GRCm38)	missense	probably damaging	1.00
IGL01949:Itgae	APN	11	73,118,184 (GRCm38)	missense	probably benign	0.29
IGL02149:Itgae	APN	11	73,103,894 (GRCm38)	missense	probably benign	0.04
IGL02179:Itgae	APN	11	73,134,018 (GRCm38)	missense	probably benign	0.06
IGL02231:Itgae	APN	11	73,090,622 (GRCm38)	missense	possibly damaging	0.88
IGL02292:Itgae	APN	11	73,118,535 (GRCm38)	missense	probably damaging	0.98
IGL02378:Itgae	APN	11	73,118,121 (GRCm38)	missense	probably benign	0.00
IGL02525:Itgae	APN	11	73,130,951 (GRCm38)	missense	probably damaging	0.98
IGL02576:Itgae	APN	11	73,118,505 (GRCm38)	missense	possibly damaging	0.95
IGL02729:Itgae	APN	11	73,118,203 (GRCm38)	splice site	probably benign
IGL02859:Itgae	APN	11	73,114,867 (GRCm38)	missense	probably damaging	1.00
IGL03074:Itgae	APN	11	73,125,310 (GRCm38)	missense	probably benign	0.00
IGL03107:Itgae	APN	11	73,113,601 (GRCm38)	missense	probably damaging	1.00
IGL03264:Itgae	APN	11	73,115,574 (GRCm38)	missense	possibly damaging	0.73
IGL03272:Itgae	APN	11	73,133,854 (GRCm38)	splice site	probably null
IGL03352:Itgae	APN	11	73,131,730 (GRCm38)	missense	probably damaging	1.00
R0134:Itgae	UTSW	11	73,111,342 (GRCm38)	missense	probably benign	0.00
R0225:Itgae	UTSW	11	73,111,342 (GRCm38)	missense	probably benign	0.00
R0320:Itgae	UTSW	11	73,130,999 (GRCm38)	missense	possibly damaging	0.74
R0344:Itgae	UTSW	11	73,118,147 (GRCm38)	missense	probably benign	0.13
R0403:Itgae	UTSW	11	73,123,183 (GRCm38)	missense	possibly damaging	0.89
R0631:Itgae	UTSW	11	73,114,907 (GRCm38)	missense	probably damaging	1.00
R0833:Itgae	UTSW	11	73,129,206 (GRCm38)	missense	probably benign	0.02
R0836:Itgae	UTSW	11	73,129,206 (GRCm38)	missense	probably benign	0.02
R0973:Itgae	UTSW	11	73,138,509 (GRCm38)	nonsense	probably null
R1231:Itgae	UTSW	11	73,119,379 (GRCm38)	missense	probably benign	0.02
R1389:Itgae	UTSW	11	73,125,362 (GRCm38)	missense	probably damaging	1.00
R1433:Itgae	UTSW	11	73,115,592 (GRCm38)	missense	probably damaging	1.00
R1534:Itgae	UTSW	11	73,145,605 (GRCm38)	missense	possibly damaging	0.58
R1833:Itgae	UTSW	11	73,117,162 (GRCm38)	missense	possibly damaging	0.94
R1914:Itgae	UTSW	11	73,118,643 (GRCm38)	splice site	probably benign
R1915:Itgae	UTSW	11	73,118,643 (GRCm38)	splice site	probably benign
R2061:Itgae	UTSW	11	73,118,622 (GRCm38)	missense	probably benign	0.00
R2380:Itgae	UTSW	11	73,145,569 (GRCm38)	missense	probably benign	0.00
R2435:Itgae	UTSW	11	73,121,937 (GRCm38)	nonsense	probably null
R2886:Itgae	UTSW	11	73,140,687 (GRCm38)	missense	probably benign	0.04
R3873:Itgae	UTSW	11	73,113,616 (GRCm38)	missense	probably damaging	1.00
R3923:Itgae	UTSW	11	73,116,143 (GRCm38)	missense	probably damaging	0.99
R4010:Itgae	UTSW	11	73,111,339 (GRCm38)	missense	probably benign	0.00
R4059:Itgae	UTSW	11	73,112,134 (GRCm38)	missense	probably benign
R4212:Itgae	UTSW	11	73,119,352 (GRCm38)	missense	probably benign
R4213:Itgae	UTSW	11	73,119,352 (GRCm38)	missense	probably benign
R4691:Itgae	UTSW	11	73,119,519 (GRCm38)	nonsense	probably null
R4736:Itgae	UTSW	11	73,114,880 (GRCm38)	missense	possibly damaging	0.79
R5152:Itgae	UTSW	11	73,130,995 (GRCm38)	missense	probably damaging	1.00
R5201:Itgae	UTSW	11	73,110,556 (GRCm38)	missense	probably benign	0.00
R5307:Itgae	UTSW	11	73,145,638 (GRCm38)	missense	probably benign	0.00
R5362:Itgae	UTSW	11	73,111,849 (GRCm38)	missense	probably damaging	1.00
R5448:Itgae	UTSW	11	73,133,908 (GRCm38)	critical splice donor site	probably null
R5645:Itgae	UTSW	11	73,129,248 (GRCm38)	missense	probably damaging	1.00
R5672:Itgae	UTSW	11	73,145,551 (GRCm38)	missense	possibly damaging	0.96
R6079:Itgae	UTSW	11	73,115,574 (GRCm38)	missense	possibly damaging	0.73
R6138:Itgae	UTSW	11	73,115,574 (GRCm38)	missense	possibly damaging	0.73
R6226:Itgae	UTSW	11	73,140,757 (GRCm38)	missense	probably benign	0.11
R6244:Itgae	UTSW	11	73,145,601 (GRCm38)	missense	probably damaging	0.96
R6326:Itgae	UTSW	11	73,131,693 (GRCm38)	missense	possibly damaging	0.88
R6332:Itgae	UTSW	11	73,111,402 (GRCm38)	splice site	probably null
R6502:Itgae	UTSW	11	73,145,592 (GRCm38)	missense	probably benign	0.10
R6825:Itgae	UTSW	11	73,118,496 (GRCm38)	missense	possibly damaging	0.89
R7016:Itgae	UTSW	11	73,119,516 (GRCm38)	missense	probably damaging	0.99
R7020:Itgae	UTSW	11	73,111,369 (GRCm38)	missense	probably damaging	1.00
R7069:Itgae	UTSW	11	73,116,143 (GRCm38)	missense	probably damaging	0.99
R7132:Itgae	UTSW	11	73,111,358 (GRCm38)	missense	possibly damaging	0.93
R7473:Itgae	UTSW	11	73,140,678 (GRCm38)	missense	possibly damaging	0.87
R7599:Itgae	UTSW	11	73,121,960 (GRCm38)	missense	possibly damaging	0.62
R7637:Itgae	UTSW	11	73,113,631 (GRCm38)	missense	probably damaging	1.00
R7763:Itgae	UTSW	11	73,123,269 (GRCm38)	critical splice donor site	probably null
R7829:Itgae	UTSW	11	73,138,792 (GRCm38)	missense	probably benign
R7860:Itgae	UTSW	11	73,120,273 (GRCm38)	critical splice acceptor site	probably null
R7978:Itgae	UTSW	11	73,134,087 (GRCm38)	missense	probably damaging	0.98
R8197:Itgae	UTSW	11	73,120,384 (GRCm38)	missense	probably benign
R8911:Itgae	UTSW	11	73,113,621 (GRCm38)	missense	probably damaging	1.00
R9155:Itgae	UTSW	11	73,125,263 (GRCm38)	missense	possibly damaging	0.94
R9284:Itgae	UTSW	11	73,121,926 (GRCm38)	missense	probably benign	0.25
R9355:Itgae	UTSW	11	73,116,080 (GRCm38)	missense	probably damaging	1.00
R9414:Itgae	UTSW	11	73,111,803 (GRCm38)	missense	possibly damaging	0.59
R9595:Itgae	UTSW	11	73,125,356 (GRCm38)	missense	probably damaging	0.99
R9618:Itgae	UTSW	11	73,120,345 (GRCm38)	missense	possibly damaging	0.78
U15987:Itgae	UTSW	11	73,115,574 (GRCm38)	missense	possibly damaging	0.73
X0024:Itgae	UTSW	11	73,111,376 (GRCm38)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1186:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36
Z1186:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1186:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1186:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1186:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1187:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1187:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1187:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1187:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1187:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1188:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36
Z1188:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1188:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1188:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1188:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1189:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1189:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36
Z1189:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1189:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1189:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1189:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36
Z1190:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1190:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1190:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1190:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1190:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1191:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36
Z1191:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1191:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1191:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1191:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73,121,957 (GRCm38)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,121,931 (GRCm38)	missense	probably benign	0.00
Z1192:Itgae	UTSW	11	73,118,087 (GRCm38)	missense	probably benign	0.01
Z1192:Itgae	UTSW	11	73,115,640 (GRCm38)	missense	probably benign
Z1192:Itgae	UTSW	11	73,103,960 (GRCm38)	missense	probably damaging	1.00
Z1192:Itgae	UTSW	11	73,103,887 (GRCm38)	missense	possibly damaging	0.74
Z1192:Itgae	UTSW	11	73,134,127 (GRCm38)	missense	probably benign	0.36

Predicted Primers

PCR Primer
(F):5'- GTGCTCTTACAATGTGGAGCAG -3'
(R):5'- TGGATAGGATACACAGTCTCCAC -3'

Sequencing Primer
(F):5'- TGTGTGATGCAAATCCGCC -3'
(R):5'- AGTCTCCACTGGGCTGCTC -3'

Posted On

2014-12-04