Incidental Mutation 'R2495:Cnksr1'
ID250945
Institutional Source Beutler Lab
Gene Symbol Cnksr1
Ensembl Gene ENSMUSG00000028841
Gene Nameconnector enhancer of kinase suppressor of Ras 1
Synonyms
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134228041-134238399 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 134232162 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 387 (L387Q)
Ref Sequence ENSEMBL: ENSMUSP00000030645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030645] [ENSMUST00000055892] [ENSMUST00000105878] [ENSMUST00000169381]
Predicted Effect probably benign
Transcript: ENSMUST00000030645
AA Change: L387Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030645
Gene: ENSMUSG00000028841
AA Change: L387Q

DomainStartEndE-ValueType
SAM 4 70 1.44e-9 SMART
Pfam:CRIC_ras_sig 78 162 4.2e-26 PFAM
PDZ 206 276 1.48e-3 SMART
low complexity region 285 303 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
PH 388 488 4.38e-19 SMART
coiled coil region 596 624 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055892
SMART Domains Protein: ENSMUSP00000051694
Gene: ENSMUSG00000048003

DomainStartEndE-ValueType
Pfam:Ion_trans 67 294 6.9e-34 PFAM
Pfam:PKD_channel 149 289 8.1e-8 PFAM
low complexity region 304 315 N/A INTRINSIC
coiled coil region 353 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105878
SMART Domains Protein: ENSMUSP00000101504
Gene: ENSMUSG00000048003

DomainStartEndE-ValueType
transmembrane domain 64 86 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146283
Predicted Effect probably benign
Transcript: ENSMUST00000169381
SMART Domains Protein: ENSMUSP00000131094
Gene: ENSMUSG00000048003

DomainStartEndE-ValueType
Pfam:Ion_trans 56 209 2.4e-11 PFAM
low complexity region 231 242 N/A INTRINSIC
coiled coil region 280 310 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing several motifs involved in protein-protein interaction, including PDZ, PH (Pleckstrin homology), and SAM (sterile alpha motif) domains. The encoded protein acts as a scaffold component for receptor tyrosine kinase signaling and may mediate crosstalk between different signaling pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Cnksr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Cnksr1 APN 4 134234701 missense probably benign 0.39
IGL01311:Cnksr1 APN 4 134230466 missense probably damaging 1.00
IGL01872:Cnksr1 APN 4 134228964 missense probably benign 0.13
IGL02082:Cnksr1 APN 4 134236052 missense probably damaging 1.00
IGL02405:Cnksr1 APN 4 134236281 missense possibly damaging 0.88
IGL02669:Cnksr1 APN 4 134230463 missense probably damaging 0.98
IGL02948:Cnksr1 APN 4 134235106 splice site probably null
IGL03037:Cnksr1 APN 4 134235106 splice site probably null
IGL03381:Cnksr1 APN 4 134232171 missense probably damaging 0.99
R0855:Cnksr1 UTSW 4 134233066 splice site probably benign
R1958:Cnksr1 UTSW 4 134228416 missense probably benign 0.02
R2049:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2140:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2141:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2142:Cnksr1 UTSW 4 134229628 missense probably damaging 1.00
R2389:Cnksr1 UTSW 4 134233746 missense probably benign 0.03
R4596:Cnksr1 UTSW 4 134233878 missense possibly damaging 0.90
R4668:Cnksr1 UTSW 4 134232971 intron probably benign
R4896:Cnksr1 UTSW 4 134229675 splice site probably null
R5367:Cnksr1 UTSW 4 134230214 missense possibly damaging 0.94
R5673:Cnksr1 UTSW 4 134235188 missense probably damaging 1.00
R5844:Cnksr1 UTSW 4 134228264 unclassified probably benign
R6153:Cnksr1 UTSW 4 134233893 missense probably damaging 1.00
R7207:Cnksr1 UTSW 4 134235123 missense possibly damaging 0.75
R7261:Cnksr1 UTSW 4 134235773 intron probably null
Predicted Primers PCR Primer
(F):5'- GCGGCTCTCTGATGTAGAAG -3'
(R):5'- AAAGCCACTCTACCTGAGGATG -3'

Sequencing Primer
(F):5'- GTAAAGACGGTGACCCTCAGATTC -3'
(R):5'- ACTCTACCTGAGGATGTCTGTAAC -3'
Posted On2014-12-04