Incidental Mutation 'R2495:Crmp1'
ID 250947
Institutional Source Beutler Lab
Gene Symbol Crmp1
Ensembl Gene ENSMUSG00000029121
Gene Name collapsin response mediator protein 1
Synonyms Ulip3, DRP-1
MMRRC Submission 040409-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.391) question?
Stock # R2495 (G1)
Quality Score 186
Status Validated
Chromosome 5
Chromosomal Location 37399402-37449507 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 37403441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031004] [ENSMUST00000114158] [ENSMUST00000201834] [ENSMUST00000202434] [ENSMUST00000202652]
AlphaFold P97427
PDB Structure X-ray structure of NYSGRC target T-45 [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000031004
SMART Domains Protein: ENSMUSP00000031004
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 9.1e-35 PFAM
Pfam:Amidohydro_3 333 454 8.5e-10 PFAM
low complexity region 507 530 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114158
SMART Domains Protein: ENSMUSP00000109795
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 178 567 5.2e-34 PFAM
Pfam:Amidohydro_3 448 568 2.8e-10 PFAM
low complexity region 621 644 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201315
Predicted Effect probably benign
Transcript: ENSMUST00000201834
SMART Domains Protein: ENSMUSP00000144408
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 143 3.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202434
SMART Domains Protein: ENSMUSP00000143847
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
PDB:1KCX|B 128 191 3e-36 PDB
SCOP:d1gkpa1 131 190 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202652
SMART Domains Protein: ENSMUSP00000143895
Gene: ENSMUSG00000029121

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 155 1.2e-10 PFAM
Meta Mutation Damage Score 0.9232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a protein that is part of the collapsin response mediator protein family. The family is comprised of five, homologous cytosolic phosphoproteins that are expressed in developing and adult nervous tissue and mediate signaling to transduce responses to extracellular cues. This protein is a Semaphorin 3A signaling molecule that regulates collapse of the growth cone. The growth cone mediates axonal pathfinding in neurons. This protein is reported to represent a new class of microtubule-associated proteins. In humans this protein is reported to inhibit cancer cell invasion. In mouse deficiency of this gene may be associated with impaired spatial memory performance. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for one knock-out allele show transient postnatal changes in granule cell proliferation, apoptosis and migration in cerebellum and delayed radial migration of cortical neurons in cerebral cortex. Homozygotes for another knock-out allele show reduced LTP and impaired spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,536,109 (GRCm39) F125S unknown Het
Abhd17c C T 7: 83,759,884 (GRCm39) W290* probably null Het
Acsl5 A T 19: 55,282,031 (GRCm39) K536* probably null Het
Adamts14 A T 10: 61,034,749 (GRCm39) probably null Het
Agbl3 A G 6: 34,823,699 (GRCm39) H788R probably damaging Het
Agrp T C 8: 106,293,408 (GRCm39) N126D possibly damaging Het
Ambn T C 5: 88,615,663 (GRCm39) I349T probably benign Het
Ank1 T C 8: 23,622,280 (GRCm39) W1610R probably damaging Het
Aox3 T C 1: 58,227,567 (GRCm39) L1224P probably damaging Het
Arhgef28 A T 13: 98,165,881 (GRCm39) probably benign Het
Bcl11b G A 12: 107,881,706 (GRCm39) H798Y possibly damaging Het
Capn11 T A 17: 45,949,689 (GRCm39) M426L probably damaging Het
Cep95 A G 11: 106,700,108 (GRCm39) K290E possibly damaging Het
Cic A G 7: 24,991,201 (GRCm39) probably benign Het
Cnbd1 A T 4: 18,860,579 (GRCm39) M389K probably damaging Het
Cnksr1 A T 4: 133,959,473 (GRCm39) L387Q probably benign Het
Cntrob G T 11: 69,213,749 (GRCm39) P14T probably damaging Het
Dido1 A G 2: 180,331,181 (GRCm39) V89A probably benign Het
Dnah7a T A 1: 53,645,040 (GRCm39) I999F probably damaging Het
Dsp T A 13: 38,377,453 (GRCm39) L1746Q possibly damaging Het
Dst T C 1: 34,238,454 (GRCm39) S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 (GRCm39) F887L probably benign Het
Gm21961 T A 15: 64,886,722 (GRCm39) H11L unknown Het
Gm4559 A T 7: 141,827,557 (GRCm39) C182S unknown Het
Golga3 T A 5: 110,355,462 (GRCm39) S939T probably damaging Het
Got2 A G 8: 96,614,918 (GRCm39) S6P possibly damaging Het
Gpatch8 A T 11: 102,369,307 (GRCm39) H1410Q probably damaging Het
Gpx5 T A 13: 21,475,610 (GRCm39) T39S probably benign Het
Grin2b T C 6: 135,710,180 (GRCm39) Y1122C probably damaging Het
Gsn A C 2: 35,193,205 (GRCm39) N538T probably damaging Het
Helz2 A G 2: 180,874,705 (GRCm39) S1930P probably damaging Het
Krt6b A T 15: 101,586,757 (GRCm39) F286Y probably damaging Het
Lrriq1 G A 10: 103,038,242 (GRCm39) R854C probably damaging Het
Mipol1 A T 12: 57,507,776 (GRCm39) probably benign Het
Mmp19 A G 10: 128,626,819 (GRCm39) probably benign Het
Msc T G 1: 14,825,473 (GRCm39) Y167S probably benign Het
Mycbp2 T G 14: 103,437,554 (GRCm39) K2103Q probably damaging Het
Myh11 C A 16: 14,023,421 (GRCm39) D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 (GRCm39) D791E probably damaging Het
Pcm1 A G 8: 41,746,616 (GRCm39) T1272A probably benign Het
Phgdh A G 3: 98,247,105 (GRCm39) L15P probably damaging Het
Ptprk A T 10: 28,351,074 (GRCm39) probably benign Het
Ralgapa2 G T 2: 146,203,320 (GRCm39) D1091E possibly damaging Het
Rbbp8nl C A 2: 179,920,895 (GRCm39) K496N probably null Het
Rbm26 T C 14: 105,388,748 (GRCm39) probably benign Het
Rfx6 A C 10: 51,602,771 (GRCm39) probably benign Het
Rras G A 7: 44,667,488 (GRCm39) G17R probably damaging Het
Shisa6 G A 11: 66,108,459 (GRCm39) P473S probably damaging Het
Slc9a3 A G 13: 74,306,822 (GRCm39) K316E probably damaging Het
Slco1a7 C A 6: 141,711,503 (GRCm39) M69I probably benign Het
Spata31d1a A G 13: 59,849,807 (GRCm39) S774P possibly damaging Het
Spsb4 T C 9: 96,877,840 (GRCm39) Y161C probably damaging Het
Taf3 G T 2: 9,957,644 (GRCm39) N174K probably damaging Het
Tectb C G 19: 55,169,431 (GRCm39) probably benign Het
Trnt1 T A 6: 106,750,330 (GRCm39) V78E possibly damaging Het
Ubox5 A T 2: 130,441,441 (GRCm39) C415* probably null Het
Ucn2 C T 9: 108,815,477 (GRCm39) P80S possibly damaging Het
Vmn2r10 G A 5: 109,143,961 (GRCm39) T663I probably damaging Het
Wdfy1 A T 1: 79,685,222 (GRCm39) F337L probably null Het
Zfp287 A T 11: 62,605,459 (GRCm39) C483S probably damaging Het
Zyg11b A G 4: 108,101,921 (GRCm39) probably null Het
Other mutations in Crmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Crmp1 APN 5 37,433,657 (GRCm39) missense probably damaging 0.99
IGL02506:Crmp1 APN 5 37,436,199 (GRCm39) splice site probably benign
IGL02904:Crmp1 APN 5 37,446,262 (GRCm39) missense possibly damaging 0.80
IGL02946:Crmp1 APN 5 37,441,424 (GRCm39) missense probably damaging 1.00
IGL02981:Crmp1 APN 5 37,443,770 (GRCm39) missense probably damaging 0.97
IGL03068:Crmp1 APN 5 37,422,633 (GRCm39) missense possibly damaging 0.69
R0049:Crmp1 UTSW 5 37,422,617 (GRCm39) missense possibly damaging 0.52
R0049:Crmp1 UTSW 5 37,422,617 (GRCm39) missense possibly damaging 0.52
R0105:Crmp1 UTSW 5 37,441,479 (GRCm39) missense probably damaging 1.00
R0105:Crmp1 UTSW 5 37,441,479 (GRCm39) missense probably damaging 1.00
R0331:Crmp1 UTSW 5 37,422,657 (GRCm39) missense possibly damaging 0.79
R1226:Crmp1 UTSW 5 37,430,778 (GRCm39) missense probably damaging 1.00
R1372:Crmp1 UTSW 5 37,446,155 (GRCm39) missense probably benign 0.14
R1651:Crmp1 UTSW 5 37,430,783 (GRCm39) missense probably damaging 0.97
R1653:Crmp1 UTSW 5 37,443,812 (GRCm39) missense probably damaging 1.00
R1951:Crmp1 UTSW 5 37,430,699 (GRCm39) missense possibly damaging 0.81
R1977:Crmp1 UTSW 5 37,433,627 (GRCm39) missense probably damaging 1.00
R2107:Crmp1 UTSW 5 37,399,838 (GRCm39) missense probably benign 0.04
R2295:Crmp1 UTSW 5 37,422,606 (GRCm39) missense probably benign
R3417:Crmp1 UTSW 5 37,426,031 (GRCm39) missense possibly damaging 0.48
R3788:Crmp1 UTSW 5 37,441,484 (GRCm39) missense probably damaging 1.00
R4490:Crmp1 UTSW 5 37,433,675 (GRCm39) missense probably damaging 0.99
R5338:Crmp1 UTSW 5 37,437,018 (GRCm39) missense probably benign 0.16
R5592:Crmp1 UTSW 5 37,422,609 (GRCm39) missense probably benign 0.09
R5761:Crmp1 UTSW 5 37,440,212 (GRCm39) missense probably benign 0.15
R6243:Crmp1 UTSW 5 37,446,288 (GRCm39) missense probably damaging 1.00
R6726:Crmp1 UTSW 5 37,441,408 (GRCm39) missense probably benign 0.04
R6750:Crmp1 UTSW 5 37,422,666 (GRCm39) critical splice donor site probably null
R7013:Crmp1 UTSW 5 37,426,036 (GRCm39) splice site probably null
R7183:Crmp1 UTSW 5 37,446,161 (GRCm39) missense probably benign 0.01
R7360:Crmp1 UTSW 5 37,433,624 (GRCm39) missense possibly damaging 0.95
R7419:Crmp1 UTSW 5 37,436,229 (GRCm39) missense probably benign 0.03
R7792:Crmp1 UTSW 5 37,441,439 (GRCm39) missense probably damaging 1.00
R8427:Crmp1 UTSW 5 37,448,539 (GRCm39) missense probably damaging 1.00
R8479:Crmp1 UTSW 5 37,441,502 (GRCm39) missense possibly damaging 0.59
R8762:Crmp1 UTSW 5 37,441,440 (GRCm39) missense probably damaging 1.00
R8993:Crmp1 UTSW 5 37,399,490 (GRCm39) start codon destroyed probably null 0.68
R9027:Crmp1 UTSW 5 37,437,947 (GRCm39) nonsense probably null
R9477:Crmp1 UTSW 5 37,446,182 (GRCm39) missense probably damaging 1.00
R9778:Crmp1 UTSW 5 37,422,619 (GRCm39) missense probably benign 0.32
Z1177:Crmp1 UTSW 5 37,435,468 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGGAGCTGTCTGTCTTCAG -3'
(R):5'- TTCCTCTGAAGGCTGCAAGG -3'

Sequencing Primer
(F):5'- TGGGAGCCGAGCTTCTGTC -3'
(R):5'- TCCCCATCCTAGAGTGAGGC -3'
Posted On 2014-12-04