Incidental Mutation 'R2680:Heatr4'
List |< first << previous [record 19 of 66] next >> last >|
ID250950
Institutional Source Beutler Lab
Gene Symbol Heatr4
Ensembl Gene ENSMUSG00000090843
Gene NameHEAT repeat containing 4
SynonymsGm17673
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location83954499-83984852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83980463 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 7 (K7E)
Ref Sequence ENSEMBL: ENSMUSP00000129832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164935]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164935
AA Change: K7E

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129832
Gene: ENSMUSG00000090843
AA Change: K7E

DomainStartEndE-ValueType
low complexity region 153 166 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 289 303 N/A INTRINSIC
low complexity region 533 548 N/A INTRINSIC
internal_repeat_1 577 711 2.78e-6 PROSPERO
Pfam:HEAT_2 776 890 1.8e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Heatr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1070:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1225:Heatr4 UTSW 12 83978046 missense probably benign 0.01
R1398:Heatr4 UTSW 12 83967621 missense possibly damaging 0.45
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1467:Heatr4 UTSW 12 83978067 missense possibly damaging 0.70
R1626:Heatr4 UTSW 12 83973721 missense probably benign 0.00
R1728:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1779:Heatr4 UTSW 12 83980160 missense probably benign 0.30
R1784:Heatr4 UTSW 12 83967572 missense probably benign 0.03
R1860:Heatr4 UTSW 12 83979728 nonsense probably null
R1903:Heatr4 UTSW 12 83958447 missense probably damaging 1.00
R1916:Heatr4 UTSW 12 83955817 missense probably benign 0.21
R1972:Heatr4 UTSW 12 83955020 missense probably damaging 1.00
R2008:Heatr4 UTSW 12 83979740 missense probably benign 0.01
R2081:Heatr4 UTSW 12 83980322 missense probably damaging 0.99
R2093:Heatr4 UTSW 12 83975081 missense possibly damaging 0.63
R2399:Heatr4 UTSW 12 83980333 missense probably benign 0.00
R4618:Heatr4 UTSW 12 83978067 missense probably damaging 1.00
R6400:Heatr4 UTSW 12 83955010 missense probably null 1.00
R6527:Heatr4 UTSW 12 83979763 missense probably damaging 1.00
R6616:Heatr4 UTSW 12 83980130 missense probably benign
R6815:Heatr4 UTSW 12 83979727 missense probably damaging 0.96
R7070:Heatr4 UTSW 12 83969858 missense probably benign
R7219:Heatr4 UTSW 12 83957870 missense possibly damaging 0.89
R7329:Heatr4 UTSW 12 83978082 missense probably benign 0.00
R7477:Heatr4 UTSW 12 83979830 missense probably damaging 0.97
R7570:Heatr4 UTSW 12 83979644 missense probably benign 0.10
R7709:Heatr4 UTSW 12 83957725 missense probably damaging 0.98
R8280:Heatr4 UTSW 12 83969896 missense probably benign
R8423:Heatr4 UTSW 12 83980330 missense probably benign 0.04
R8465:Heatr4 UTSW 12 83977933 critical splice donor site probably null
R8515:Heatr4 UTSW 12 83954704 missense probably damaging 1.00
R8694:Heatr4 UTSW 12 83980264 missense probably damaging 1.00
Z1177:Heatr4 UTSW 12 83980478 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TACTGGGTCTTGAGTCTCTCGC -3'
(R):5'- TTGCTCCCTAAACTCCCAGG -3'

Sequencing Primer
(F):5'- TTGAGTCTCTCGCAGTGCCG -3'
(R):5'- TAATTCCTCCCAACCTAGAGTAGTC -3'
Posted On2014-12-04