Incidental Mutation 'R2495:Ambn'
ID250951
Institutional Source Beutler Lab
Gene Symbol Ambn
Ensembl Gene ENSMUSG00000029288
Gene Nameameloblastin
Synonyms
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location88455991-88468531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88467804 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 349 (I349T)
Ref Sequence ENSEMBL: ENSMUSP00000031226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031226] [ENSMUST00000198265]
AlphaFold O55189
Predicted Effect probably benign
Transcript: ENSMUST00000031226
AA Change: I349T

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031226
Gene: ENSMUSG00000029288
AA Change: I349T

DomainStartEndE-ValueType
Amelin 11 407 7.19e-250 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198265
AA Change: I364T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000142944
Gene: ENSMUSG00000029288
AA Change: I364T

DomainStartEndE-ValueType
Amelin 11 422 8.22e-268 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes an extracellular matrix glycoprotein that is involved in the formation of dental enamel. Mice lacking the encoded protein fail to undergo normal ameloblast differentiation and develop enamel. Mice overproducing the product of this gene develop thinner and more porous enamel, with disrupted rod patterns and abnormal crystallites. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice lack enamel and display abnormal ameloblast and tooth morphology and an increased incidence of dental epithelium derived tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Ambn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ambn APN 5 88459359 missense probably damaging 0.99
IGL01139:Ambn APN 5 88464517 splice site probably benign
IGL01318:Ambn APN 5 88460695 splice site probably benign
IGL02139:Ambn APN 5 88465290 missense probably benign
IGL02261:Ambn APN 5 88456948 missense probably damaging 1.00
IGL02743:Ambn APN 5 88464484 missense probably damaging 0.99
IGL03329:Ambn APN 5 88461668 missense probably benign 0.34
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0563:Ambn UTSW 5 88463450 missense probably benign 0.28
R1649:Ambn UTSW 5 88464481 missense probably benign 0.16
R2118:Ambn UTSW 5 88460758 splice site probably benign
R2121:Ambn UTSW 5 88460758 splice site probably benign
R2124:Ambn UTSW 5 88460758 splice site probably benign
R2877:Ambn UTSW 5 88460700 splice site probably benign
R3779:Ambn UTSW 5 88465342 splice site probably benign
R4760:Ambn UTSW 5 88467707 missense probably damaging 1.00
R5422:Ambn UTSW 5 88464511 critical splice donor site probably null
R5755:Ambn UTSW 5 88464491 splice site probably null
R5883:Ambn UTSW 5 88467829 nonsense probably null
R5970:Ambn UTSW 5 88467951 missense possibly damaging 0.88
R6846:Ambn UTSW 5 88461715 missense possibly damaging 0.65
R7166:Ambn UTSW 5 88467528 missense possibly damaging 0.94
R7500:Ambn UTSW 5 88461634 missense possibly damaging 0.95
R7809:Ambn UTSW 5 88467824 missense probably benign 0.00
R8306:Ambn UTSW 5 88459422 missense possibly damaging 0.95
R8898:Ambn UTSW 5 88465192 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTGTTACCAAAGGCCCTG -3'
(R):5'- TTATCAGGGCTCTTGGAAACGC -3'

Sequencing Primer
(F):5'- GAAGGCTCTCCACTGCAAGAG -3'
(R):5'- GGTGATATCCATGGTTGC -3'
Posted On2014-12-04