Incidental Mutation 'R2495:Vmn2r10'
ID250953
Institutional Source Beutler Lab
Gene Symbol Vmn2r10
Ensembl Gene ENSMUSG00000067010
Gene Namevomeronasal 2, receptor 10
SynonymsV2r16, VR16
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location108993412-109006471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108996095 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 663 (T663I)
Ref Sequence ENSEMBL: ENSMUSP00000078162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079163] [ENSMUST00000176594]
Predicted Effect probably damaging
Transcript: ENSMUST00000079163
AA Change: T663I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000078162
Gene: ENSMUSG00000067010
AA Change: T663I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 8.5e-29 PFAM
Pfam:NCD3G 506 560 3.8e-17 PFAM
Pfam:7tm_3 593 828 4e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176594
SMART Domains Protein: ENSMUSP00000135274
Gene: ENSMUSG00000067010

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Vmn2r10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Vmn2r10 APN 5 109002585 missense possibly damaging 0.75
IGL01618:Vmn2r10 APN 5 109002479 missense probably damaging 1.00
IGL01624:Vmn2r10 APN 5 109006246 missense possibly damaging 0.83
IGL01941:Vmn2r10 APN 5 108995954 missense probably damaging 1.00
IGL01959:Vmn2r10 APN 5 108997705 missense probably benign 0.00
IGL01973:Vmn2r10 APN 5 108995677 missense probably damaging 1.00
IGL01985:Vmn2r10 APN 5 109006259 missense probably benign 0.21
IGL02451:Vmn2r10 APN 5 108995922 nonsense probably null
IGL02503:Vmn2r10 APN 5 109003475 missense probably damaging 1.00
IGL03275:Vmn2r10 APN 5 109003377 missense probably benign 0.00
R0035:Vmn2r10 UTSW 5 108997601 splice site probably benign
R0395:Vmn2r10 UTSW 5 109001993 missense probably damaging 1.00
R0454:Vmn2r10 UTSW 5 109003461 missense probably benign 0.25
R0648:Vmn2r10 UTSW 5 108995916 missense probably benign 0.00
R1251:Vmn2r10 UTSW 5 108996024 missense probably benign 0.01
R1580:Vmn2r10 UTSW 5 109006251 missense possibly damaging 0.82
R1845:Vmn2r10 UTSW 5 109001995 nonsense probably null
R1986:Vmn2r10 UTSW 5 109006254 nonsense probably null
R2137:Vmn2r10 UTSW 5 109003544 missense possibly damaging 0.87
R3932:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R3933:Vmn2r10 UTSW 5 109002222 missense possibly damaging 0.47
R4899:Vmn2r10 UTSW 5 109003458 missense probably damaging 1.00
R4992:Vmn2r10 UTSW 5 108997726 missense possibly damaging 0.89
R5124:Vmn2r10 UTSW 5 109006420 missense probably benign 0.01
R5145:Vmn2r10 UTSW 5 108995895 missense possibly damaging 0.64
R5156:Vmn2r10 UTSW 5 108995600 missense probably benign 0.11
R5265:Vmn2r10 UTSW 5 108995720 missense probably damaging 1.00
R5311:Vmn2r10 UTSW 5 109006255 missense probably damaging 1.00
R5321:Vmn2r10 UTSW 5 108995639 missense probably damaging 1.00
R5666:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5670:Vmn2r10 UTSW 5 108999044 nonsense probably null
R5872:Vmn2r10 UTSW 5 109003511 missense possibly damaging 0.84
R6004:Vmn2r10 UTSW 5 108999078 missense probably benign 0.30
R6108:Vmn2r10 UTSW 5 108995801 missense probably damaging 1.00
R6332:Vmn2r10 UTSW 5 109003462 missense probably damaging 1.00
R6599:Vmn2r10 UTSW 5 108996078 missense probably benign 0.09
R6651:Vmn2r10 UTSW 5 108995622 missense probably null 0.22
R6891:Vmn2r10 UTSW 5 109001979 missense probably damaging 1.00
R7023:Vmn2r10 UTSW 5 109002028 missense probably damaging 0.96
R7146:Vmn2r10 UTSW 5 109003334 missense probably damaging 1.00
R7941:Vmn2r10 UTSW 5 108996440 missense probably damaging 1.00
R8058:Vmn2r10 UTSW 5 109002089 missense probably benign 0.00
Z1088:Vmn2r10 UTSW 5 108996113 missense probably damaging 1.00
Z1176:Vmn2r10 UTSW 5 109001988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAATTACTGAGCCTTTGTTGC -3'
(R):5'- GCCCTCACAGTTCTAGTACTAGTC -3'

Sequencing Primer
(F):5'- TGCATATCTCTGTCAATAAAGGGAGG -3'
(R):5'- CACAGTTCTAGTACTAGTCACTTTTG -3'
Posted On2014-12-04