Incidental Mutation 'R2495:Golga3'
ID250955
Institutional Source Beutler Lab
Gene Symbol Golga3
Ensembl Gene ENSMUSG00000029502
Gene Namegolgi autoantigen, golgin subfamily a, 3
Synonymsrepro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2495 (G1)
Quality Score224
Status Validated
Chromosome5
Chromosomal Location110176701-110226470 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 110207596 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 939 (S939T)
Ref Sequence ENSEMBL: ENSMUSP00000108131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031477
AA Change: S979T

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502
AA Change: S979T

DomainStartEndE-ValueType
internal_repeat_1 24 49 7.67e-5 PROSPERO
internal_repeat_1 91 116 7.67e-5 PROSPERO
low complexity region 232 245 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 312 321 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 422 441 N/A INTRINSIC
internal_repeat_2 444 484 7.67e-5 PROSPERO
low complexity region 534 548 N/A INTRINSIC
internal_repeat_2 587 624 7.67e-5 PROSPERO
coiled coil region 656 1379 N/A INTRINSIC
coiled coil region 1417 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112512
AA Change: S939T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502
AA Change: S939T

DomainStartEndE-ValueType
internal_repeat_2 3 24 9.29e-5 PROSPERO
low complexity region 192 205 N/A INTRINSIC
low complexity region 229 248 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 322 335 N/A INTRINSIC
low complexity region 382 401 N/A INTRINSIC
internal_repeat_1 404 444 4.91e-5 PROSPERO
low complexity region 494 508 N/A INTRINSIC
internal_repeat_1 547 584 4.91e-5 PROSPERO
low complexity region 705 717 N/A INTRINSIC
low complexity region 792 809 N/A INTRINSIC
low complexity region 1105 1117 N/A INTRINSIC
low complexity region 1220 1228 N/A INTRINSIC
low complexity region 1312 1330 N/A INTRINSIC
internal_repeat_2 1333 1359 9.29e-5 PROSPERO
coiled coil region 1377 1413 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199123
Meta Mutation Damage Score 0.0775 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Golga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Golga3 APN 5 110220887 missense probably damaging 1.00
IGL00594:Golga3 APN 5 110204975 missense probably benign 0.37
IGL00672:Golga3 APN 5 110212244 missense probably damaging 1.00
IGL00821:Golga3 APN 5 110204933 missense possibly damaging 0.74
IGL01015:Golga3 APN 5 110187717 missense probably benign 0.04
IGL01408:Golga3 APN 5 110217809 critical splice acceptor site probably null
IGL01651:Golga3 APN 5 110192905 critical splice acceptor site probably null
IGL02617:Golga3 APN 5 110188746 missense probably benign 0.26
tenta UTSW 5 110218130 nonsense probably null
PIT4544001:Golga3 UTSW 5 110188690 missense possibly damaging 0.94
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0058:Golga3 UTSW 5 110202777 missense possibly damaging 0.85
R0591:Golga3 UTSW 5 110188743 missense probably damaging 1.00
R1219:Golga3 UTSW 5 110184349 nonsense probably null
R1297:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1299:Golga3 UTSW 5 110204843 missense probably benign 0.04
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1465:Golga3 UTSW 5 110209878 missense probably damaging 1.00
R1589:Golga3 UTSW 5 110181783 missense probably damaging 1.00
R1795:Golga3 UTSW 5 110207627 missense possibly damaging 0.47
R1992:Golga3 UTSW 5 110192973 missense probably damaging 0.96
R2116:Golga3 UTSW 5 110187395 missense probably damaging 0.97
R2130:Golga3 UTSW 5 110202939 critical splice donor site probably null
R2153:Golga3 UTSW 5 110187990 splice site probably null
R2158:Golga3 UTSW 5 110187361 missense probably damaging 1.00
R2357:Golga3 UTSW 5 110202648 missense probably damaging 1.00
R2397:Golga3 UTSW 5 110205877 splice site probably benign
R2418:Golga3 UTSW 5 110201868 missense probably damaging 1.00
R2763:Golga3 UTSW 5 110204895 missense possibly damaging 0.87
R3276:Golga3 UTSW 5 110201998 splice site probably benign
R3614:Golga3 UTSW 5 110220908 missense probably damaging 1.00
R4520:Golga3 UTSW 5 110203751 nonsense probably null
R5001:Golga3 UTSW 5 110205777 missense probably damaging 1.00
R5046:Golga3 UTSW 5 110192940 missense probably damaging 0.99
R5157:Golga3 UTSW 5 110202671 missense probably benign 0.00
R5191:Golga3 UTSW 5 110184307 intron probably benign
R5376:Golga3 UTSW 5 110220945 critical splice donor site probably null
R5399:Golga3 UTSW 5 110205024 missense probably damaging 0.96
R5407:Golga3 UTSW 5 110201990 nonsense probably null
R5884:Golga3 UTSW 5 110216895 missense probably damaging 1.00
R6087:Golga3 UTSW 5 110204946 missense probably damaging 0.99
R6526:Golga3 UTSW 5 110204895 missense probably damaging 0.98
R6651:Golga3 UTSW 5 110218130 nonsense probably null
R7041:Golga3 UTSW 5 110208584 critical splice donor site probably null
R7057:Golga3 UTSW 5 110188663 missense probably damaging 1.00
R7078:Golga3 UTSW 5 110193087 missense probably damaging 0.99
R7114:Golga3 UTSW 5 110202712 missense probably benign 0.01
R7190:Golga3 UTSW 5 110209855 missense probably damaging 1.00
R7405:Golga3 UTSW 5 110208446 missense probably damaging 0.97
R7528:Golga3 UTSW 5 110212232 missense probably damaging 1.00
R7638:Golga3 UTSW 5 110205828 missense probably benign
R7760:Golga3 UTSW 5 110205850 missense probably benign 0.39
R8099:Golga3 UTSW 5 110188707 nonsense probably null
R8144:Golga3 UTSW 5 110185879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTCTTTCAAAAGCTAGTACCCG -3'
(R):5'- ACGGGGAGAAATGTGTTTACC -3'

Sequencing Primer
(F):5'- AACTGGTCTTCCGAAAGTCCTGAG -3'
(R):5'- CTACATGTAGGACAGGGTCAC -3'
Posted On2014-12-04