Incidental Mutation 'R2680:Ndst2'
List |< first << previous [record 33 of 66] next >> last >|
ID250956
Institutional Source Beutler Lab
Gene Symbol Ndst2
Ensembl Gene ENSMUSG00000039308
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms[Heparan sulfate]-glucosamine N-sulfotransferase, glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns
MMRRC Submission 040433-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location20723730-20734562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20724754 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 794 (F794L)
Ref Sequence ENSEMBL: ENSMUSP00000153141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022358] [ENSMUST00000047490] [ENSMUST00000223679] [ENSMUST00000223840] [ENSMUST00000224751] [ENSMUST00000225000] [ENSMUST00000225419]
Predicted Effect probably benign
Transcript: ENSMUST00000022358
SMART Domains Protein: ENSMUSP00000022358
Gene: ENSMUSG00000021819

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
low complexity region 578 612 N/A INTRINSIC
low complexity region 736 751 N/A INTRINSIC
low complexity region 1000 1015 N/A INTRINSIC
low complexity region 1120 1135 N/A INTRINSIC
low complexity region 1176 1211 N/A INTRINSIC
low complexity region 1259 1270 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1470 1487 N/A INTRINSIC
low complexity region 1491 1511 N/A INTRINSIC
low complexity region 1527 1542 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047490
AA Change: F794L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040227
Gene: ENSMUSG00000039308
AA Change: F794L

DomainStartEndE-ValueType
Pfam:HSNSD 25 514 9.1e-245 PFAM
Pfam:Sulfotransfer_1 603 866 9.1e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223561
Predicted Effect probably damaging
Transcript: ENSMUST00000223679
AA Change: F794L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223782
Predicted Effect probably benign
Transcript: ENSMUST00000223840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224234
Predicted Effect probably benign
Transcript: ENSMUST00000224751
Predicted Effect unknown
Transcript: ENSMUST00000224829
AA Change: F142L
Predicted Effect probably damaging
Transcript: ENSMUST00000225000
AA Change: F794L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225010
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225320
Predicted Effect probably benign
Transcript: ENSMUST00000225419
Predicted Effect probably benign
Transcript: ENSMUST00000225911
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-deacetylase/N-sulfotransferase subfamily of the sulfotransferase 1 proteins. The encoded enzyme has dual functions in processing glucosamine and heparin polymers, including N-deacetylation and N-sulfation. The encoded protein may be localized to the Golgi. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozugous for a null allele exhibit reduced mast cell numbers, histamine storage, protease storage and degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dab2 A G 15: 6,436,993 Q729R possibly damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Ndst2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ndst2 APN 14 20724484 missense probably benign 0.11
IGL00650:Ndst2 APN 14 20729668 missense possibly damaging 0.77
IGL01565:Ndst2 APN 14 20728206 missense probably damaging 0.98
IGL01746:Ndst2 APN 14 20729414 missense probably benign 0.02
IGL02457:Ndst2 APN 14 20729554 missense possibly damaging 0.95
IGL03193:Ndst2 APN 14 20729849 missense probably damaging 0.97
IGL03238:Ndst2 APN 14 20728504 missense probably damaging 1.00
IGL03277:Ndst2 APN 14 20730166 missense possibly damaging 0.92
R0090:Ndst2 UTSW 14 20727267 missense probably damaging 0.98
R0481:Ndst2 UTSW 14 20724468 missense possibly damaging 0.70
R0677:Ndst2 UTSW 14 20729579 missense probably benign 0.06
R0834:Ndst2 UTSW 14 20729693 missense probably damaging 1.00
R1015:Ndst2 UTSW 14 20730064 missense probably damaging 1.00
R1354:Ndst2 UTSW 14 20724975 missense possibly damaging 0.74
R1678:Ndst2 UTSW 14 20724514 missense probably benign 0.00
R2853:Ndst2 UTSW 14 20729896 missense probably damaging 1.00
R5000:Ndst2 UTSW 14 20724907 critical splice donor site probably null
R5266:Ndst2 UTSW 14 20724487 missense probably damaging 1.00
R6737:Ndst2 UTSW 14 20727494 missense probably damaging 1.00
R7109:Ndst2 UTSW 14 20729843 missense probably damaging 1.00
R7506:Ndst2 UTSW 14 20730085 missense probably benign
R7646:Ndst2 UTSW 14 20724459 critical splice donor site probably null
R7985:Ndst2 UTSW 14 20728410 splice site probably null
R8094:Ndst2 UTSW 14 20728164 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGTCAGGTGTCAGCAAGAAG -3'
(R):5'- CTTGCAGAACCGTTGTCTTG -3'

Sequencing Primer
(F):5'- AGGGTACTCAAGGCACCGAC -3'
(R):5'- AACGCTGGCTGACTTACTATC -3'
Posted On2014-12-04