Incidental Mutation 'R2495:Trnt1'
ID 250959
Institutional Source Beutler Lab
Gene Symbol Trnt1
Ensembl Gene ENSMUSG00000013736
Gene Name tRNA nucleotidyl transferase, CCA-adding, 1
Synonyms CGI-47, 2410043H24Rik, 2610044E04Rik
MMRRC Submission 040409-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.965) question?
Stock # R2495 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 106769120-106782474 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 106773369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 78 (V78E)
Ref Sequence ENSEMBL: ENSMUSP00000144850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057578] [ENSMUST00000113247] [ENSMUST00000113248] [ENSMUST00000113249] [ENSMUST00000204782] [ENSMUST00000205163]
AlphaFold Q8K1J6
Predicted Effect possibly damaging
Transcript: ENSMUST00000057578
AA Change: V78E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000060900
Gene: ENSMUSG00000013736
AA Change: V78E

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113247
AA Change: V78E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108873
Gene: ENSMUSG00000013736
AA Change: V78E

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 7.7e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113248
AA Change: V78E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108874
Gene: ENSMUSG00000013736
AA Change: V78E

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 2.4e-37 PFAM
Pfam:PolyA_pol_RNAbd 215 272 9.3e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113249
AA Change: V78E

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108875
Gene: ENSMUSG00000013736
AA Change: V78E

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 182 3.8e-36 PFAM
Pfam:PolyA_pol_RNAbd 215 271 1.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154026
Predicted Effect possibly damaging
Transcript: ENSMUST00000204782
AA Change: V78E

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144850
Gene: ENSMUSG00000013736
AA Change: V78E

DomainStartEndE-ValueType
Pfam:PolyA_pol 59 134 3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205163
SMART Domains Protein: ENSMUSP00000144943
Gene: ENSMUSG00000013736

DomainStartEndE-ValueType
PDB:1OU5|B 30 72 2e-22 PDB
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a CCA-adding enzyme which belongs to the tRNA nucleotidyltransferase/poly(A) polymerase family. This essential enzyme functions by catalyzing the addition of the conserved nucleotide triplet CCA to the 3' terminus of tRNA molecules. Mutations in this gene result in sideroblastic anemia with B-cell immunodeficiency, periodic fevers, and developmental delay. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Trnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Trnt1 APN 6 106776222 nonsense probably null
IGL00915:Trnt1 APN 6 106779426 missense probably benign 0.00
IGL01821:Trnt1 APN 6 106774475 missense probably damaging 1.00
IGL02102:Trnt1 APN 6 106778112 critical splice donor site probably null
IGL02610:Trnt1 APN 6 106778818 missense possibly damaging 0.88
IGL02933:Trnt1 APN 6 106773426 missense probably benign 0.40
R0606:Trnt1 UTSW 6 106777908 unclassified probably benign
R0844:Trnt1 UTSW 6 106774503 missense probably damaging 1.00
R2144:Trnt1 UTSW 6 106778039 missense probably damaging 1.00
R4994:Trnt1 UTSW 6 106778892 nonsense probably null
R5294:Trnt1 UTSW 6 106773414 missense probably damaging 1.00
R5742:Trnt1 UTSW 6 106778917 nonsense probably null
R6855:Trnt1 UTSW 6 106777922 missense probably damaging 1.00
R7491:Trnt1 UTSW 6 106778904 missense probably benign
R7492:Trnt1 UTSW 6 106774532 missense possibly damaging 0.76
R7880:Trnt1 UTSW 6 106769556 critical splice donor site probably null
R8212:Trnt1 UTSW 6 106769871 missense probably benign
R8863:Trnt1 UTSW 6 106774482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATACAAGATTGCTCAGTTCACTG -3'
(R):5'- GGCGGCATGGACATTTCTATTG -3'

Sequencing Primer
(F):5'- CAGTTCACTGACCTCTACTATCTG -3'
(R):5'- ACGGGACAAAAATGTTACACTTC -3'
Posted On 2014-12-04