Incidental Mutation 'R2495:Gm5724'
ID250963
Institutional Source Beutler Lab
Gene Symbol Gm5724
Ensembl Gene ENSMUSG00000084927
Gene Namepredicted gene 5724
Synonyms
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2495 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location141708118-141773810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141765777 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 69 (M69I)
Ref Sequence ENSEMBL: ENSMUSP00000117177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148411]
Predicted Effect probably benign
Transcript: ENSMUST00000148411
AA Change: M69I

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117177
Gene: ENSMUSG00000084927
AA Change: M69I

DomainStartEndE-ValueType
Pfam:MFS_1 22 405 3.4e-26 PFAM
KAZAL 438 484 1.71e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Got2 A G 8: 95,888,290 S6P possibly damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Gm5724
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Gm5724 APN 6 141754429 missense probably benign 0.14
IGL01347:Gm5724 APN 6 141754466 nonsense probably null
IGL01539:Gm5724 APN 6 141727607 missense possibly damaging 0.88
IGL01613:Gm5724 APN 6 141713214 missense possibly damaging 0.67
IGL02060:Gm5724 APN 6 141754408 missense probably benign 0.00
IGL02063:Gm5724 APN 6 141738889 missense probably benign 0.01
IGL02126:Gm5724 APN 6 141739013 missense probably benign 0.29
IGL02214:Gm5724 APN 6 141723185 missense possibly damaging 0.50
IGL02630:Gm5724 APN 6 141723110 missense probably damaging 1.00
R0966:Gm5724 UTSW 6 141727573 missense probably benign 0.00
R1082:Gm5724 UTSW 6 141712133 missense probably damaging 1.00
R1433:Gm5724 UTSW 6 141765703 missense probably benign 0.00
R1571:Gm5724 UTSW 6 141754409 nonsense probably null
R1765:Gm5724 UTSW 6 141754358 splice site probably benign
R2055:Gm5724 UTSW 6 141725455 missense probably benign 0.33
R2174:Gm5724 UTSW 6 141727593 nonsense probably null
R2857:Gm5724 UTSW 6 141744538 missense probably benign 0.35
R3551:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R3824:Gm5724 UTSW 6 141754374 missense possibly damaging 0.50
R3912:Gm5724 UTSW 6 141727636 missense probably damaging 0.97
R3942:Gm5724 UTSW 6 141727714 missense probably damaging 0.98
R4161:Gm5724 UTSW 6 141708596 missense probably benign 0.20
R4168:Gm5724 UTSW 6 141738947 missense probably benign 0.03
R4395:Gm5724 UTSW 6 141712118 missense probably benign 0.02
R4720:Gm5724 UTSW 6 141723222 missense probably damaging 1.00
R4732:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4733:Gm5724 UTSW 6 141723179 missense probably benign 0.01
R4794:Gm5724 UTSW 6 141767562 missense probably benign 0.11
R5062:Gm5724 UTSW 6 141767454 missense possibly damaging 0.46
R5389:Gm5724 UTSW 6 141740467 missense probably benign 0.12
R5419:Gm5724 UTSW 6 141736100 splice site probably null
R5423:Gm5724 UTSW 6 141744462 missense probably damaging 1.00
R5704:Gm5724 UTSW 6 141713254 missense probably benign 0.00
R5973:Gm5724 UTSW 6 141754456 missense probably benign 0.01
R6041:Gm5724 UTSW 6 141739038 missense probably benign 0.11
R6284:Gm5724 UTSW 6 141725393 missense probably damaging 1.00
R6395:Gm5724 UTSW 6 141723092 splice site probably null
R6993:Gm5724 UTSW 6 141765742 missense possibly damaging 0.94
R7149:Gm5724 UTSW 6 141744452 missense probably damaging 1.00
R7159:Gm5724 UTSW 6 141773778 start codon destroyed probably damaging 1.00
R7627:Gm5724 UTSW 6 141744545 missense probably damaging 1.00
R7784:Gm5724 UTSW 6 141713193 critical splice donor site probably null
R7873:Gm5724 UTSW 6 141727722 missense probably benign 0.44
X0020:Gm5724 UTSW 6 141754365 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTCATTTCCTGTAGGTG -3'
(R):5'- AAATATCCTAAGCTCCTGTCCCTG -3'

Sequencing Primer
(F):5'- GAGCCTCATTTCCTGTAGGTGAAAAG -3'
(R):5'- TTGATGATATAGCTGCAAGGAGCTC -3'
Posted On2014-12-04