Incidental Mutation 'R2680:Dab2'
ID250964
Institutional Source Beutler Lab
Gene Symbol Dab2
Ensembl Gene ENSMUSG00000022150
Gene Namedisabled 2, mitogen-responsive phosphoprotein
Synonyms5730435J12Rik, p96, D630005B22Rik, D15Wsu122e
MMRRC Submission 040433-MU
Accession Numbers

Genbank: NM_023118, NM_001008702, MGI: 109175

Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock #R2680 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6299788-6440712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6436993 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 729 (Q729R)
Ref Sequence ENSEMBL: ENSMUSP00000106292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110663] [ENSMUST00000110664] [ENSMUST00000161812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078019
AA Change: Q532R

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150
AA Change: Q532R

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000080880
AA Change: Q750R

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150
AA Change: Q750R

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000110663
AA Change: Q532R

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106291
Gene: ENSMUSG00000022150
AA Change: Q532R

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000110664
AA Change: Q729R

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150
AA Change: Q729R

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159552
Predicted Effect probably benign
Transcript: ENSMUST00000161812
AA Change: Q511R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124589
Gene: ENSMUSG00000022150
AA Change: Q511R

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 249 267 N/A INTRINSIC
low complexity region 271 285 N/A INTRINSIC
low complexity region 314 334 N/A INTRINSIC
low complexity region 357 373 N/A INTRINSIC
PDB:3H8D|H 444 472 2e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000163082
AA Change: Q617R
SMART Domains Protein: ENSMUSP00000124996
Gene: ENSMUSG00000022150
AA Change: Q617R

DomainStartEndE-ValueType
Blast:PTB 2 59 1e-33 BLAST
PDB:1P3R|C 2 59 2e-34 PDB
SCOP:d1ddma_ 3 59 9e-12 SMART
low complexity region 60 79 N/A INTRINSIC
low complexity region 356 374 N/A INTRINSIC
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 441 N/A INTRINSIC
low complexity region 464 480 N/A INTRINSIC
PDB:3H8D|H 551 579 3e-12 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mutants exhibit abnormal primitive endoderm structure and/or function, lack a proamniotic cavity and die prior to embryonic day 9.5. A conditional mutant survives, but shows kidney proximal tubule abnormality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430531B16Rik T C 7: 139,978,561 D41G probably damaging Het
BC024139 A G 15: 76,121,739 W421R probably damaging Het
Car11 T C 7: 45,702,485 S113P probably benign Het
Ccdc146 C T 5: 21,305,269 A582T possibly damaging Het
Cct8l1 A G 5: 25,517,135 T283A probably benign Het
Ckap5 A G 2: 91,588,698 I1118V probably benign Het
Copa C T 1: 172,121,404 Q1199* probably null Het
Cpd A T 11: 76,790,999 N1140K probably benign Het
Cspp1 A G 1: 10,104,305 D661G probably damaging Het
Dnah9 T C 11: 66,033,925 I2168V probably benign Het
Dync1h1 G A 12: 110,643,247 R2821H probably damaging Het
Ercc5 T C 1: 44,156,973 V42A probably benign Het
Evc A G 5: 37,310,237 V566A probably benign Het
Fcrls T C 3: 87,257,349 Y290C probably damaging Het
Frmd4a A G 2: 4,534,553 R171G probably damaging Het
Galnt17 G A 5: 131,111,823 P152L probably damaging Het
Gfi1 A G 5: 107,721,431 L245P probably damaging Het
Heatr4 T C 12: 83,980,463 K7E possibly damaging Het
Ifit3b A G 19: 34,612,305 N294D probably benign Het
Ift74 A G 4: 94,653,028 Y230C probably damaging Het
Igsf10 C T 3: 59,325,454 V1953I probably benign Het
Ikzf5 T C 7: 131,396,761 D14G probably damaging Het
Il12rb2 T A 6: 67,354,805 T259S possibly damaging Het
Itgae T A 11: 73,114,926 D305E probably damaging Het
Kif23 A C 9: 61,937,476 D90E probably benign Het
Kprp A G 3: 92,824,463 F427L unknown Het
Lmnb1 T A 18: 56,731,105 Y261N probably damaging Het
Megf8 T C 7: 25,317,556 V17A probably benign Het
Mfap4 T C 11: 61,487,231 Y190H probably benign Het
Mlh1 T C 9: 111,236,017 probably null Het
Mocos C A 18: 24,676,629 Q430K probably damaging Het
Ndst2 A G 14: 20,724,754 F794L probably damaging Het
Nedd4l A T 18: 65,163,130 I197F possibly damaging Het
Nefm A G 14: 68,123,786 L343P probably damaging Het
Nfatc4 A G 14: 55,832,834 probably benign Het
Nlrp4a T A 7: 26,449,230 probably null Het
Nlrp4f A T 13: 65,194,343 L496* probably null Het
Nom1 T C 5: 29,443,417 F654S probably damaging Het
Olfr730 A T 14: 50,186,847 Y123* probably null Het
Pcdhac2 A G 18: 37,145,586 K540E possibly damaging Het
Pde4dip T C 3: 97,701,617 N1974S possibly damaging Het
Pik3c3 T C 18: 30,344,078 probably null Het
Pik3ca T C 3: 32,443,885 I492T probably benign Het
Pik3ca C T 3: 32,436,548 R115* probably null Het
Ppp1ca G A 19: 4,194,595 E218K possibly damaging Het
Prex1 G T 2: 166,601,772 D492E possibly damaging Het
Scaf8 T C 17: 3,197,591 V1063A possibly damaging Het
Scn3a G T 2: 65,536,536 N47K probably benign Het
Sec61a2 G T 2: 5,873,745 N348K probably benign Het
Sh3rf2 A G 18: 42,101,650 E166G probably damaging Het
Slc19a2 C A 1: 164,249,413 T54K probably damaging Het
Slc8a3 T A 12: 81,202,339 I765F probably damaging Het
Snap91 A T 9: 86,879,550 M1K probably null Het
Strc T C 2: 121,365,111 H1619R probably damaging Het
Tbl1xr1 C T 3: 22,191,451 T207M possibly damaging Het
Tchp T C 5: 114,709,519 probably null Het
Tln1 A T 4: 43,539,668 F1581Y probably damaging Het
Tnxb T C 17: 34,703,620 V2469A possibly damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn1r225 T A 17: 20,502,793 F165L probably benign Het
Vmn2r13 T C 5: 109,174,312 D173G possibly damaging Het
Vmn2r6 A C 3: 64,538,286 S673A possibly damaging Het
Vta1 G A 10: 14,705,427 probably benign Het
Wwc1 T C 11: 35,875,929 T500A probably benign Het
Zfp784 T A 7: 5,036,117 Q147H possibly damaging Het
Other mutations in Dab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dab2 APN 15 6429825 missense probably benign 0.00
IGL00731:Dab2 APN 15 6435710 missense possibly damaging 0.95
IGL02382:Dab2 APN 15 6436987 missense possibly damaging 0.62
IGL02598:Dab2 APN 15 6429366 missense probably damaging 0.97
IGL03054:Dab2 APN 15 6418226 unclassified probably benign
IGL03093:Dab2 APN 15 6436411 missense probably damaging 1.00
IGL03369:Dab2 APN 15 6435309 missense possibly damaging 0.64
IGL03372:Dab2 APN 15 6429549 missense probably damaging 0.99
R0157:Dab2 UTSW 15 6429827 missense probably benign 0.00
R0326:Dab2 UTSW 15 6418316 missense probably damaging 1.00
R0488:Dab2 UTSW 15 6424654 missense probably damaging 1.00
R0552:Dab2 UTSW 15 6435414 missense possibly damaging 0.65
R0938:Dab2 UTSW 15 6435384 missense probably benign 0.04
R1433:Dab2 UTSW 15 6429938 missense probably damaging 1.00
R1635:Dab2 UTSW 15 6429870 missense possibly damaging 0.80
R1713:Dab2 UTSW 15 6429701 missense possibly damaging 0.94
R1757:Dab2 UTSW 15 6330452 intron probably benign
R1800:Dab2 UTSW 15 6435467 missense probably benign
R1837:Dab2 UTSW 15 6336476 intron probably benign
R1999:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2050:Dab2 UTSW 15 6435215 missense possibly damaging 0.47
R2117:Dab2 UTSW 15 6435615 missense probably damaging 1.00
R2129:Dab2 UTSW 15 6336383 nonsense probably null
R2150:Dab2 UTSW 15 6416917 missense probably benign 0.32
R2329:Dab2 UTSW 15 6429563 missense possibly damaging 0.80
R2338:Dab2 UTSW 15 6435252 missense possibly damaging 0.62
R3978:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3979:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R3980:Dab2 UTSW 15 6435163 critical splice acceptor site probably null
R4551:Dab2 UTSW 15 6435294 missense probably damaging 0.97
R4795:Dab2 UTSW 15 6429611 missense probably benign 0.16
R4829:Dab2 UTSW 15 6424681 missense probably damaging 1.00
R4830:Dab2 UTSW 15 6427527 missense probably benign
R4832:Dab2 UTSW 15 6336599 intron probably null
R5168:Dab2 UTSW 15 6336443 intron probably benign
R5620:Dab2 UTSW 15 6418315 missense probably damaging 0.98
R5996:Dab2 UTSW 15 6435311 nonsense probably null
R6159:Dab2 UTSW 15 6436460 missense possibly damaging 0.93
R6998:Dab2 UTSW 15 6424649 missense possibly damaging 0.49
R7002:Dab2 UTSW 15 6435365 missense probably benign 0.01
R7040:Dab2 UTSW 15 6422251 missense probably damaging 1.00
R7138:Dab2 UTSW 15 6429299 missense probably benign 0.24
R7448:Dab2 UTSW 15 6422266 missense probably damaging 1.00
R7548:Dab2 UTSW 15 6429918 missense possibly damaging 0.80
R8062:Dab2 UTSW 15 6427341 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATTGATGGGAGAAGCTGAATC -3'
(R):5'- GAGCATTGATTTCCATATCTGCTAC -3'

Sequencing Primer
(F):5'- GATCGTCCATCAAAAACAATTCTTC -3'
(R):5'- TTACACATACTCAACCTCCT -3'
Posted On2014-12-04