Incidental Mutation 'R2495:Got2'
ID250977
Institutional Source Beutler Lab
Gene Symbol Got2
Ensembl Gene ENSMUSG00000031672
Gene Nameglutamatic-oxaloacetic transaminase 2, mitochondrial
SynonymsFABP-pm, Got-2, plasma membrane fatty acid binding protein, mitochondrial aspartate aminotransferase, mAspAT
MMRRC Submission 040409-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock #R2495 (G1)
Quality Score158
Status Validated
Chromosome8
Chromosomal Location95864134-95888547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95888290 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 6 (S6P)
Ref Sequence ENSEMBL: ENSMUSP00000034097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034097]
PDB Structure
Crystal Structure of Mouse Mitochondrial Aspartate Aminotransferase/Kynurenine Aminotransferase IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase, a newly identified kynurenine aminotransferase-IV [X-RAY DIFFRACTION]
Crystal structure of mouse mitochondrial aspartate aminotransferase in complex with oxaloacetic acid [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034097
AA Change: S6P

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034097
Gene: ENSMUSG00000031672
AA Change: S6P

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:Aminotran_1_2 57 425 4.8e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212861
Meta Mutation Damage Score 0.2237 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamic-oxaloacetic transaminase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and inner-membrane mitochondrial forms, GOT1 and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,481,960 F125S unknown Het
Abhd17c C T 7: 84,110,676 W290* probably null Het
Acsl5 A T 19: 55,293,599 K536* probably null Het
Adamts14 A T 10: 61,198,970 probably null Het
Agbl3 A G 6: 34,846,764 H788R probably damaging Het
Agrp T C 8: 105,566,776 N126D possibly damaging Het
Ambn T C 5: 88,467,804 I349T probably benign Het
Ank1 T C 8: 23,132,264 W1610R probably damaging Het
Aox3 T C 1: 58,188,408 L1224P probably damaging Het
Arhgef28 A T 13: 98,029,373 probably benign Het
Bcl11b G A 12: 107,915,447 H798Y possibly damaging Het
Capn11 T A 17: 45,638,763 M426L probably damaging Het
Cep95 A G 11: 106,809,282 K290E possibly damaging Het
Cic A G 7: 25,291,776 probably benign Het
Cnbd1 A T 4: 18,860,579 M389K probably damaging Het
Cnksr1 A T 4: 134,232,162 L387Q probably benign Het
Cntrob G T 11: 69,322,923 P14T probably damaging Het
Crmp1 G A 5: 37,246,097 probably null Het
Dido1 A G 2: 180,689,388 V89A probably benign Het
Dnah7a T A 1: 53,605,881 I999F probably damaging Het
Dsp T A 13: 38,193,477 L1746Q possibly damaging Het
Dst T C 1: 34,199,373 S3897P probably damaging Het
Fbxo10 A G 4: 45,040,545 F887L probably benign Het
Gm21961 T A 15: 65,014,873 H11L unknown Het
Gm4559 A T 7: 142,273,820 C182S unknown Het
Gm5724 C A 6: 141,765,777 M69I probably benign Het
Golga3 T A 5: 110,207,596 S939T probably damaging Het
Gpatch8 A T 11: 102,478,481 H1410Q probably damaging Het
Gpx5 T A 13: 21,291,440 T39S probably benign Het
Grin2b T C 6: 135,733,182 Y1122C probably damaging Het
Gsn A C 2: 35,303,193 N538T probably damaging Het
Helz2 A G 2: 181,232,912 S1930P probably damaging Het
Krt6b A T 15: 101,678,322 F286Y probably damaging Het
Lrriq1 G A 10: 103,202,381 R854C probably damaging Het
Mipol1 A T 12: 57,460,990 probably benign Het
Mmp19 A G 10: 128,790,950 probably benign Het
Msc T G 1: 14,755,249 Y167S probably benign Het
Mycbp2 T G 14: 103,200,118 K2103Q probably damaging Het
Myh11 C A 16: 14,205,557 D1586Y probably damaging Het
Nol6 A T 4: 41,118,427 D791E probably damaging Het
Pcm1 A G 8: 41,293,579 T1272A probably benign Het
Phgdh A G 3: 98,339,789 L15P probably damaging Het
Ptprk A T 10: 28,475,078 probably benign Het
Ralgapa2 G T 2: 146,361,400 D1091E possibly damaging Het
Rbbp8nl C A 2: 180,279,102 K496N probably null Het
Rbm26 T C 14: 105,151,312 probably benign Het
Rfx6 A C 10: 51,726,675 probably benign Het
Rras G A 7: 45,018,064 G17R probably damaging Het
Shisa6 G A 11: 66,217,633 P473S probably damaging Het
Slc9a3 A G 13: 74,158,703 K316E probably damaging Het
Spata31d1a A G 13: 59,701,993 S774P possibly damaging Het
Spsb4 T C 9: 96,995,787 Y161C probably damaging Het
Taf3 G T 2: 9,952,833 N174K probably damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Trnt1 T A 6: 106,773,369 V78E possibly damaging Het
Ubox5 A T 2: 130,599,521 C415* probably null Het
Ucn2 C T 9: 108,986,409 P80S possibly damaging Het
Vmn2r10 G A 5: 108,996,095 T663I probably damaging Het
Wdfy1 A T 1: 79,707,505 F337L probably null Het
Zfp287 A T 11: 62,714,633 C483S probably damaging Het
Zyg11b A G 4: 108,244,724 probably null Het
Other mutations in Got2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02567:Got2 APN 8 95872201 missense probably benign 0.06
Toothpick UTSW 8 95872268 missense probably benign 0.20
R0189:Got2 UTSW 8 95888253 missense probably benign 0.11
R0254:Got2 UTSW 8 95869538 missense probably benign 0.03
R1450:Got2 UTSW 8 95871986 missense probably benign 0.00
R1552:Got2 UTSW 8 95869494 missense probably benign 0.22
R3946:Got2 UTSW 8 95888230 missense probably benign
R4021:Got2 UTSW 8 95877753 missense probably damaging 1.00
R4594:Got2 UTSW 8 95872186 missense probably benign 0.15
R5087:Got2 UTSW 8 95872323 missense probably benign 0.00
R5233:Got2 UTSW 8 95875849 missense probably benign 0.33
R6156:Got2 UTSW 8 95872268 missense probably benign 0.20
R6529:Got2 UTSW 8 95888385 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TCTAAGACTCGGGACAGTCAAC -3'
(R):5'- AGTTTCCATGACCTCCGTG -3'

Sequencing Primer
(F):5'- ACTCGGGACAGTCAACCCTTG -3'
(R):5'- AGGCGTCGTCGTTCTACC -3'
Posted On2014-12-04