Mutagenetix > Incidental Mutation

Incidental Mutation 'R2680:Lmnb1'

250982

Institutional Source

Beutler Lab

Gene Symbol

Lmnb1

Ensembl Gene

ENSMUSG00000024590

Gene Name

lamin B1

Synonyms

MMRRC Submission

040433-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2680 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56707813-56753424 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 56731105 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 261 (Y261N)

Ref Sequence

ENSEMBL: ENSMUSP00000025486 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025486]

AlphaFold

P14733

Predicted Effect

probably damaging
Transcript: ENSMUST00000025486
AA Change: Y261N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025486
Gene: ENSMUSG00000024590
AA Change: Y261N

Domain	Start	End	E-Value	Type
Filament	32	388	2.59e-47	SMART
low complexity region	392	414	N/A	INTRINSIC
Pfam:LTD	436	546	2.3e-18	PFAM
low complexity region	551	570	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128651

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the two B-type lamin proteins and is a component of the nuclear lamina. A duplication of this gene is associated with autosomal dominant adult-onset leukodystrophy (ADLD). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mice display neonatal lethality with respiratory distress, abnormal lung, craniofacial, and skeletal morphology, reduced embryo size, impaired cellular proliferation and differentiation, and abnormal nuclear morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430531B16Rik	T	C	7: 139,978,561	D41G	probably damaging	Het
BC024139	A	G	15: 76,121,739	W421R	probably damaging	Het
Car11	T	C	7: 45,702,485	S113P	probably benign	Het
Ccdc146	C	T	5: 21,305,269	A582T	possibly damaging	Het
Cct8l1	A	G	5: 25,517,135	T283A	probably benign	Het
Ckap5	A	G	2: 91,588,698	I1118V	probably benign	Het
Copa	C	T	1: 172,121,404	Q1199*	probably null	Het
Cpd	A	T	11: 76,790,999	N1140K	probably benign	Het
Cspp1	A	G	1: 10,104,305	D661G	probably damaging	Het
Dab2	A	G	15: 6,436,993	Q729R	possibly damaging	Het
Dnah9	T	C	11: 66,033,925	I2168V	probably benign	Het
Dync1h1	G	A	12: 110,643,247	R2821H	probably damaging	Het
Ercc5	T	C	1: 44,156,973	V42A	probably benign	Het
Evc	A	G	5: 37,310,237	V566A	probably benign	Het
Fcrls	T	C	3: 87,257,349	Y290C	probably damaging	Het
Frmd4a	A	G	2: 4,534,553	R171G	probably damaging	Het
Galnt17	G	A	5: 131,111,823	P152L	probably damaging	Het
Gfi1	A	G	5: 107,721,431	L245P	probably damaging	Het
Heatr4	T	C	12: 83,980,463	K7E	possibly damaging	Het
Ifit3b	A	G	19: 34,612,305	N294D	probably benign	Het
Ift74	A	G	4: 94,653,028	Y230C	probably damaging	Het
Igsf10	C	T	3: 59,325,454	V1953I	probably benign	Het
Ikzf5	T	C	7: 131,396,761	D14G	probably damaging	Het
Il12rb2	T	A	6: 67,354,805	T259S	possibly damaging	Het
Itgae	T	A	11: 73,114,926	D305E	probably damaging	Het
Kif23	A	C	9: 61,937,476	D90E	probably benign	Het
Kprp	A	G	3: 92,824,463	F427L	unknown	Het
Megf8	T	C	7: 25,317,556	V17A	probably benign	Het
Mfap4	T	C	11: 61,487,231	Y190H	probably benign	Het
Mlh1	T	C	9: 111,236,017		probably null	Het
Mocos	C	A	18: 24,676,629	Q430K	probably damaging	Het
Ndst2	A	G	14: 20,724,754	F794L	probably damaging	Het
Nedd4l	A	T	18: 65,163,130	I197F	possibly damaging	Het
Nefm	A	G	14: 68,123,786	L343P	probably damaging	Het
Nfatc4	A	G	14: 55,832,834		probably benign	Het
Nlrp4a	T	A	7: 26,449,230		probably null	Het
Nlrp4f	A	T	13: 65,194,343	L496*	probably null	Het
Nom1	T	C	5: 29,443,417	F654S	probably damaging	Het
Olfr730	A	T	14: 50,186,847	Y123*	probably null	Het
Pcdhac2	A	G	18: 37,145,586	K540E	possibly damaging	Het
Pde4dip	T	C	3: 97,701,617	N1974S	possibly damaging	Het
Pik3c3	T	C	18: 30,344,078		probably null	Het
Pik3ca	C	T	3: 32,436,548	R115*	probably null	Het
Pik3ca	T	C	3: 32,443,885	I492T	probably benign	Het
Ppp1ca	G	A	19: 4,194,595	E218K	possibly damaging	Het
Prex1	G	T	2: 166,601,772	D492E	possibly damaging	Het
Scaf8	T	C	17: 3,197,591	V1063A	possibly damaging	Het
Scn3a	G	T	2: 65,536,536	N47K	probably benign	Het
Sec61a2	G	T	2: 5,873,745	N348K	probably benign	Het
Sh3rf2	A	G	18: 42,101,650	E166G	probably damaging	Het
Slc19a2	C	A	1: 164,249,413	T54K	probably damaging	Het
Slc8a3	T	A	12: 81,202,339	I765F	probably damaging	Het
Snap91	A	T	9: 86,879,550	M1K	probably null	Het
Strc	T	C	2: 121,365,111	H1619R	probably damaging	Het
Tbl1xr1	C	T	3: 22,191,451	T207M	possibly damaging	Het
Tchp	T	C	5: 114,709,519		probably null	Het
Tln1	A	T	4: 43,539,668	F1581Y	probably damaging	Het
Tnxb	T	C	17: 34,703,620	V2469A	possibly damaging	Het
Ugcg	C	T	4: 59,207,798	P46S	probably benign	Het
Vmn1r225	T	A	17: 20,502,793	F165L	probably benign	Het
Vmn2r13	T	C	5: 109,174,312	D173G	possibly damaging	Het
Vmn2r6	A	C	3: 64,538,286	S673A	possibly damaging	Het
Vta1	G	A	10: 14,705,427		probably benign	Het
Wwc1	T	C	11: 35,875,929	T500A	probably benign	Het
Zfp784	T	A	7: 5,036,117	Q147H	possibly damaging	Het

Other mutations in Lmnb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01536:Lmnb1	APN	18	56740796	missense	probably benign	0.37
IGL02139:Lmnb1	APN	18	56749799	missense	probably benign	0.00
Katmai	UTSW	18	56743276	nonsense	probably null
R0446:Lmnb1	UTSW	18	56743259	missense	probably benign	0.02
R0696:Lmnb1	UTSW	18	56740721	missense	probably damaging	0.99
R1308:Lmnb1	UTSW	18	56728475	missense	probably benign	0.06
R1309:Lmnb1	UTSW	18	56739904	frame shift	probably null
R1544:Lmnb1	UTSW	18	56749751	missense	probably benign	0.08
R3833:Lmnb1	UTSW	18	56728526	missense	probably benign	0.01
R3980:Lmnb1	UTSW	18	56731019	missense	probably damaging	1.00
R5820:Lmnb1	UTSW	18	56740786	missense	possibly damaging	0.70
R6025:Lmnb1	UTSW	18	56729384	nonsense	probably null
R6028:Lmnb1	UTSW	18	56743276	nonsense	probably null
R6346:Lmnb1	UTSW	18	56743238	missense	probably benign	0.24
R6736:Lmnb1	UTSW	18	56728469	missense	probably damaging	1.00
R8013:Lmnb1	UTSW	18	56708359	missense	probably damaging	1.00
R8944:Lmnb1	UTSW	18	56743259	missense	probably benign	0.02
R9453:Lmnb1	UTSW	18	56740042	critical splice donor site	probably null
RF004:Lmnb1	UTSW	18	56730974	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCCTTGTAAGCAGTTGGGTTTTAT -3'
(R):5'- GTTGACCGGAGCGAGTCTT -3'

Sequencing Primer
(F):5'- ATGTTCTTTTTCTCCCTGCAGG -3'
(R):5'- TTTGTACACCACACTGAATGCAGG -3'

Posted On

2014-12-04